SubtiBank SubtiBank
ytpR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ytpR

similar to Phe-tRNA synthetase (beta subunit)
locus
BSU_29820
pI
4.27
mw
21.55 kDa
protein length
201 aa Sequence Blast
gene length
606 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.10|Aminoacyl-tRNA synthetases]
  • Gene

    Coordinates
    3,052,743 → 3,053,348

    The protein

    [SW|Domains]

  • [SW|tRNA-binding domain] (aa 90-200) (accordinig to UniProt)
  • Structure

  • [PDB|3BU2] (tRNA-binding protein from Staphylococcus saprophyticus, 59% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|314D5C01B4BDDC3B122F6D4066647B143B2A6543|ytpP]-[gene|886EF2F8A9E031FDF919E01A858C1DBC1AFF1188|ytpQ]-[gene|EE559CD606562097F09DC627F431CA31129D7BC6|ytpR]
    description
    [Pubmed|21949854]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21949854], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|21949854], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A512 (ytpR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/512 NBRP B. subtilis, Japan]
  • BKE29820 (Δ[gene|EE559CD606562097F09DC627F431CA31129D7BC6|ytpR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCGTTCATAAGTAAAAATC, downstream forward: _UP4_TAGACTCCCATAAATCCGCC
  • BKK29820 (Δ[gene|EE559CD606562097F09DC627F431CA31129D7BC6|ytpR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCGTTCATAAGTAAAAATC, downstream forward: _UP4_TAGACTCCCATAAATCCGCC
  • References

  • 21949854