SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


aspartate 1-decarboxylase
13.76 kDa
protein length
127 aa Sequence Blast
gene length
384 bp Sequence Blast
biosynthesis of coenzyme A
aspartate 1-decarboxylase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of coenzyme A]
  • Gene

    2,352,592 → 2,352,975

    The protein

    Catalyzed reaction/ biological activity

  • H+ + L-aspartate --> β-alanine + CO2 (according to UniProt)
  • Protein family

  • PanD family (single member, according to UniProt)
  • Structure

  • [PDB|2C45] (from ''Mycobacterium tuberculosis'', 54% identity) [Pubmed|17001646]
  • Biological materials


  • BKE22410 (Δ[gene|EE712C1EC9E9C371847C83F7D75C189B276CD4B6|panD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCGCTCATCATTGTTCGAT, downstream forward: _UP4_TAGAAGAAAAGCCCCCTTTA
  • BKK22410 (Δ[gene|EE712C1EC9E9C371847C83F7D75C189B276CD4B6|panD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCGCTCATCATTGTTCGAT, downstream forward: _UP4_TAGAAGAAAAGCCCCCTTTA
  • References

  • 17001646,28589224,26762040,32096553