SubtiBank SubtiBank
yaaO
The papers of the month are back! Check them out! Link here

yaaO

similar to arginine decarboxylase, affects the level of [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] modification
locus
BSU00270
pI
5.71
mw
53.00 kDa
protein length
480 aa Sequence Blast
gene length
1440 bp Sequence Blast
function
control of [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] modification
product
putative arginine decarboxylase
essential
no
ec
4.1.1.19
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.14|Translation factor modification and maturation]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.8|Protein modification/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    37,720 → 39,162

    Phenotypes of a mutant

  • inactivation suppresses the swarming defect of a [gene|248F0805272FED9B38ECBB31E2872BC9EC163CE0|ymfI] mutant [pubmed|29615499]
  • The protein

    Catalyzed reaction/ biological activity

  • the protein was reported to be involved in norspermidine production and biofilm disassembly [Pubmed|22541437]; however, this is not the case [Pubmed|24529384] and the original paper has been [http://www.cell.com/cell/fulltext/S0092-8674(15)00495-X retracted]
  • Protein family

  • Orn/Lys/Arg decarboxylase class-I family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|SpeA]
  • Structure

  • [PDB|2X3L] (from ''Staphylococcus aureus'', 36% identity) [Pubmed|20419351]
  • Expression and Regulation

    Operons

    genes
    [gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]-[gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]-[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]-[gene|5B9984BBCEC1244628DC1467BE26976AD8E06286|tmk]-[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|yabB]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]-[gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]-[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN]: sigma factor, [Pubmed|22383849], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN regulon]
  • regulation

  • expressed in stationary phase
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B896 (yaaO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1895 NBRP B. subtilis, Japan]
  • BKE00270 (Δ[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAACAATCCTTTGAA, downstream forward: _UP4_GTTTATATAGAAGAGGAGAA
  • BKK00270 (Δ[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAACAATCCTTTGAA, downstream forward: _UP4_GTTTATATAGAAGAGGAGAA
  • References

  • 24529384,20876533,22541437,22383849,9987136,20419351,29615499