SubtiBank SubtiBank
yaaO
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

yaaO

similar to arginine decarboxylase
locus
BSU00270
pI
5.71
mw
53.00 kDa
protein length
480 aa Sequence Blast
gene length
1440 bp Sequence Blast
function
unknown
product
putative arginine decarboxylase
essential
no
ec
4.1.1.19
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    37,720 → 39,162

    The protein

    Catalyzed reaction/ biological activity

  • the protein was reported to be involved in norspermidine production and biofilm disassembly [Pubmed|22541437]; however, this is not the case [Pubmed|24529384] and the original paper has been [http://www.cell.com/cell/fulltext/S0092-8674(15)00495-X retracted]
  • Protein family

  • Orn/Lys/Arg decarboxylase class-I family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|SpeA]
  • Structure

  • [PDB|2X3L] (from ''Staphylococcus aureus'', 36% identity) [Pubmed|20419351]
  • Expression and Regulation

    Operons

    genes
    [gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]-[gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]-[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN]: sigma factor, [Pubmed|22383849], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN regulon]
  • regulation

  • expressed in stationary phase
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B896 (yaaO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1895 NBRP B. subtilis, Japan]
  • BKE00270 (Δ[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAACAATCCTTTGAA, downstream forward: _UP4_GTTTATATAGAAGAGGAGAA
  • BKK00270 (Δ[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAACAATCCTTTGAA, downstream forward: _UP4_GTTTATATAGAAGAGGAGAA
  • References

  • 24529384,20876533,22541437,22383849,9987136,20419351