SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


similar to arginine decarboxylase, affects the level of [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] modification
53.00 kDa
protein length
480 aa Sequence Blast
gene length
1440 bp Sequence Blast
control of [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] modification
putative arginine decarboxylase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Translation factor modification and maturation]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein modification/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    37,720 → 39,162

    Phenotypes of a mutant

  • inactivation suppresses the swarming defect of a [gene|248F0805272FED9B38ECBB31E2872BC9EC163CE0|ymfI] mutant [pubmed|29615499]
  • The protein

    Catalyzed reaction/ biological activity

  • the protein was reported to be involved in norspermidine production and biofilm disassembly [Pubmed|22541437]; however, this is not the case [Pubmed|24529384] and the original paper has been [ retracted]
  • Protein family

  • Orn/Lys/Arg decarboxylase class-I family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|SpeA]
  • Structure

  • [PDB|2X3L] (from ''Staphylococcus aureus'', 36% identity) [Pubmed|20419351]
  • Expression and Regulation



    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN]: sigma factor, [Pubmed|22383849], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN regulon]
  • regulation

  • expressed in stationary phase
  • view in new tab

    Biological materials


  • MGNA-B896 (yaaO::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE00270 (Δ[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAACAATCCTTTGAA, downstream forward: _UP4_GTTTATATAGAAGAGGAGAA
  • BKK00270 (Δ[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAACAATCCTTTGAA, downstream forward: _UP4_GTTTATATAGAAGAGGAGAA
  • References

  • 24529384,20876533,22541437,22383849,9987136,20419351,29615499