SubtiBank SubtiBank
yfmT
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yfmT

vanillin dehydrogenase
locus
BSU_07350
pI
5.08
mw
53.15 kDa
protein length
485 aa Sequence Blast
gene length
1458 bp Sequence Blast
function
unknown
product
vanillin dehydrogenase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    807,091 → 808,548

    The protein

    Catalyzed reaction/ biological activity

  • oxidation of vanillin to vanillic acid [Pubmed|26658822]
  • benzaldehyde + H2O + NAD+ --> benzoate + 2 H+ + NADH (according to UniProt)
  • 4-hydroxy-3-methoxybenzaldehyde + H2O + NAD+ --> 4-hydroxy-3-methoxybenzoate + 2 H+ + NADH (according to UniProt)
  • Protein family

  • [SW|aldehyde dehydrogenase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|F3341F205CB939498109D2A54DE842065C488DD5|AldX], [protein|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|AldY], [protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|GbsA], [protein|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|YcbD], [protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|DhaS], [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|IolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|YwdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|GabD], [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|PutC], [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|RocA]
  • Structure

  • [PDB|4DNG] (from ''Bacillus Subtilis'', 47% identity)
  • [PDB|3RHH] (from from ''Bacillus halodurans'' C-125 complexed with NADP, 32% identity, 67% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT]-[gene|63BCB42FC501B57ABC9FF252AC5D04BB729EA6B9|yfmS]
    description
    [Pubmed|9141694,15033535]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • additional information

  • in minimal medium, YfmS is present with 4,200 +/- 800 molecules per cell [PubMed|21515776]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C232 (yfmT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2230 NBRP B. subtilis, Japan]
  • BKE07350 (Δ[gene|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTCAGCATCTCCTTTA, downstream forward: _UP4_TTCCCTTATTAATGAAAAGG
  • BKK07350 (Δ[gene|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTCAGCATCTCCTTTA, downstream forward: _UP4_TTCCCTTATTAATGAAAAGG
  • labs

  • [SW|Josef Altenbuchner]
  • References

  • 9141694,15033535,26658822