SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


cytochrome P450, hydroxylase of the polyketide bacillaene produced by the pks cluster
43.26 kDa
protein length
405 aa Sequence Blast
gene length
1218 bp Sequence Blast
polyketide synthesis
hydroxylase of the polyketide produced by the pks cluster

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    1,858,566 → 1,859,783

    The protein

    Catalyzed reaction/ biological activity

  • hydroxylation of dihydrobacillaene [Pubmed|17482575]
  • Protein family

  • [SW|cytochrome P450] family (according to UniProt)
  • Paralogous protein(s)

  • [protein|A95C28DEE73AD25E28C45B88A7C03C92835F9705|CypA], [protein|8FBC9A1AC108DC99E275D7A27C18C797D3CDB936|BioI], [protein|D8E72C2523D5E6214C9CBAC2C1B27EA45378E162|YjiB]
  • Structure

  • [PDB|4YZR]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE17230 (Δ[gene|EF0F13BB682791E167EFC350BF029B08E8A1F410|pksS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCATTCTCCTCGCCT, downstream forward: _UP4_TAACATTCAAAACGCCCCCT
  • BKK17230 (Δ[gene|EF0F13BB682791E167EFC350BF029B08E8A1F410|pksS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCATTCTCCTCGCCT, downstream forward: _UP4_TAACATTCAAAACGCCCCCT
  • References

  • 17482575,21821766