SubtiBank SubtiBank
parB
The papers of the month are back! Check them out! Link here

parB

chromosome positioning near the pole and transport through the polar septum / antagonist of SMC complex to the origin of replication
locus
BSU40960
pI
8.42
mw
32.06 kDa
protein length
282 aa Sequence Blast
gene length
846 bp Sequence Blast
function
chromosome positioning before asymmetric septation
product
centromer-binding protein
essential
no
synonyms
spo0J,spo0JB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.3|DNA condensation/ segregation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • Gene

    Coordinates
    4,205,556 → 4,206,404

    Phenotypes of a mutant

  • a [gene|search|whiA ][gene|EF4BD49FCD49EE97908973581478951C8FA196C0|parB] double mutant is not viable, this can be suppressed by inactivation of [gene|search|yneA ][pubmed|29378890]
  • The protein

    Catalyzed reaction/ biological activity

  • forms DNA bridging interactions around parS to condense DNA and earmark the bacterial chromosome for segregation [pubmed|29244022]
  • inhibits [protein|5B3DB5A796ACA48390278E60478DFF13D0074A8D|ParA] dimerization and concomitant DNA-binding activity by stimulating [protein|5B3DB5A796ACA48390278E60478DFF13D0074A8D|ParA] ATPase activity [Pubmed|21235642]
  • recruits the condensin complex to the DNA origin region [Pubmed|24440393]
  • the dimer binds specifcally to the centromere-like ''parS'' sequence [Pubmed|25572315]
  • Protein family

  • parB family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|559DEDC9887B811EF80994526256ADC48BA51CE3|Noc]
  • [SW|Domains]

  • N-terminal domain (NTD, aa 1 - 96): binds [protein|5B3DB5A796ACA48390278E60478DFF13D0074A8D|ParA] [pubmed|10064607]
  • Central DNA-binding domain (CDBD, aa 102 - 216): binds parS DNA [pubmed|16306995]
  • C-terminal domain (CTD, aa 233 - 282): binding of non-specific DNA, dimerization, essential for DNA condensation [pubmed|29244022]
  • Structure

  • [PDB|4UMK] (complex with ''parS'' DNA)
  • [PDB|5U1G] [pubmed|28373206]
  • [PDB|5U1J] [pubmed|28373206]
  • [SW|Localization]

  • chromosome centromer [Pubmed|23475963]
  • Expression and Regulation

    Operons

    genes
    [gene|5B3DB5A796ACA48390278E60478DFF13D0074A8D|parA]-[gene|EF4BD49FCD49EE97908973581478951C8FA196C0|parB]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • 1S135 ( ''spo0J''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S135&Search=1S135 BGSC]
  • 1S136 ( ''spo0J''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S136&Search=1S136 BGSC]
  • 1S137 ( ''spo0J''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S137&Search=1S137 BGSC]
  • BKE40960 (Δ[gene|EF4BD49FCD49EE97908973581478951C8FA196C0|parB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCATTAATCCCTTTTCCAA, downstream forward: _UP4_TAAATGAAAAAACCATCTTT
  • BKK40960 (Δ[gene|EF4BD49FCD49EE97908973581478951C8FA196C0|parB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCATTAATCCCTTTTCCAA, downstream forward: _UP4_TAAATGAAAAAACCATCTTT
  • Labs working on this gene/protein

  • [SW|Heath Murray], Centre for Bacterial Cell Biology, Newcastle, UK [http://www.ncl.ac.uk/camb/staff/profile/heath.murray homepage]
  • References

    Reviews

  • 22934648,26706151,28075389
  • Original publications

  • 17462018,16677298,12562803,10852876,10482533,9506522,8071208,17932079,21235642,26253537,9663676,11532141,15659156,18854156,9159397,8866474,9778525,16925562,1900505,9364919,9701805,12950914,14651647,19450517,19450516,14563866,23475963,21911367,24440393,24829297,24696501,25071173,25572315,25951515,26295962,28154080,28373206,28407103,29244022,16306995,29378890,30100265