SubtiBank SubtiBank
parB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

parB

chromosome positioning near the pole and transport through the polar septum / antagonist of SMC complex to the origin of replication, coordination of early steps in DNA replication with establishment of a medial division site
locus
BSU_40960
pI
8.42
mw
32.06 kDa
protein length
282 aa Sequence Blast
gene length
849 bp Sequence Blast
function
chromosome positioning before asymmetric septation
product
centromer-binding protein
essential
no
synonyms
spo0J,spo0JB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.3|DNA condensation/ segregation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • Gene

    Coordinates
    4,205,556 → 4,206,404

    Phenotypes of a mutant

  • a [gene|search|whiA ][gene|EF4BD49FCD49EE97908973581478951C8FA196C0|parB] double mutant is not viable, this can be suppressed by inactivation of [gene|search|yneA ][pubmed|29378890]
  • The protein

    Catalyzed reaction/ biological activity

  • forms DNA bridging interactions around parS to condense DNA and earmark the bacterial chromosome for segregation [pubmed|29244022]
  • inhibits [protein|5B3DB5A796ACA48390278E60478DFF13D0074A8D|ParA] dimerization and concomitant DNA-binding activity by stimulating [protein|5B3DB5A796ACA48390278E60478DFF13D0074A8D|ParA] ATPase activity [Pubmed|21235642]
  • recruits the condensin complex to the DNA origin region [Pubmed|24440393]
  • the dimer binds specifcally to the centromere-like ''parS'' sequence [Pubmed|25572315]
  • prevents Z ring assembly over the bacterial nucleoid and helps fine tune the assembly of the Z ring at midcell during the cell cycle [pubmed|31152469]
  • Protein family

  • ParB family (with [protein|559DEDC9887B811EF80994526256ADC48BA51CE3|Noc], according to UniProt)
  • Paralogous protein(s)

  • [protein|559DEDC9887B811EF80994526256ADC48BA51CE3|Noc]
  • [SW|Domains]

  • N-terminal domain (NTD, aa 1 - 96): binds [protein|5B3DB5A796ACA48390278E60478DFF13D0074A8D|ParA] [pubmed|10064607]
  • Central DNA-binding domain (CDBD, aa 102 - 216): binds parS DNA [pubmed|16306995]
  • C-terminal domain (CTD, aa 233 - 282): binding of non-specific DNA, dimerization, essential for DNA condensation [pubmed|29244022]
  • Structure

  • [PDB|4UMK] (complex with ''parS'' DNA)
  • [PDB|5U1G] [pubmed|28373206]
  • [PDB|5U1J] [pubmed|28373206]
  • [SW|Localization]

  • chromosome centromer [Pubmed|23475963]
  • Expression and Regulation

    Operons

    genes
    [gene|5B3DB5A796ACA48390278E60478DFF13D0074A8D|parA]-[gene|EF4BD49FCD49EE97908973581478951C8FA196C0|parB]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • 1S135 ( ''spo0J''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S135&Search=1S135 BGSC]
  • 1S136 ( ''spo0J''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S136&Search=1S136 BGSC]
  • 1S137 ( ''spo0J''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S137&Search=1S137 BGSC]
  • BKE40960 (Δ[gene|EF4BD49FCD49EE97908973581478951C8FA196C0|parB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCATTAATCCCTTTTCCAA, downstream forward: _UP4_TAAATGAAAAAACCATCTTT
  • BKK40960 (Δ[gene|EF4BD49FCD49EE97908973581478951C8FA196C0|parB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCATTAATCCCTTTTCCAA, downstream forward: _UP4_TAAATGAAAAAACCATCTTT
  • labs

  • [SW|Heath Murray], Centre for Bacterial Cell Biology, Newcastle, UK [http://www.ncl.ac.uk/camb/staff/profile/heath.murray homepage]
  • References

    Reviews

  • 22934648,26706151,28075389,30863373,31254421
  • Original publications

  • 17462018,16677298,12562803,10852876,10482533,9506522,8071208,17932079,21235642,26253537,9663676,11532141,15659156,18854156,9159397,8866474,9778525,16925562,1900505,9364919,9701805,12950914,14651647,19450517,19450516,14563866,23475963,21911367,24440393,24829297,24696501,25071173,25572315,25951515,26295962,28154080,28373206,28407103,29244022,16306995,29378890,30100265,30907359,31152469,16885474