SubtiBank SubtiBank
yrhP
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yrhP

similar to efflux protein
locus
BSU_27100
pI
10.42
mw
23.24 kDa
protein length
210 aa Sequence Blast
gene length
633 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,768,042 → 2,768,674

    The protein

    Protein family

  • rht family (with [protein|78B3F9580DED32469ACF537F4B40C7DBF0D4D995|YcgF], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|EF88D8038D43AD4DB8893F8333C738F1265A0E95|yrhP]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B512 (yrhP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1511 NBRP B. subtilis, Japan]
  • BKE27100 (Δ[gene|EF88D8038D43AD4DB8893F8333C738F1265A0E95|yrhP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCTCTCCCCCTTTA, downstream forward: _UP4_TAACACTTAAATGAAGTGAA
  • BKK27100 (Δ[gene|EF88D8038D43AD4DB8893F8333C738F1265A0E95|yrhP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCTCTCCCCCTTTA, downstream forward: _UP4_TAACACTTAAATGAAGTGAA