SubtiBank SubtiBank
yhjB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yhjB

similar to metabolite permease
locus
BSU_10450
pI
9.63
mw
52.60 kDa
protein length
489 aa Sequence Blast
gene length
1470 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.7|Sodium-solute symporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • Gene

    Coordinates
    1,119,162 → 1,120,631

    The protein

    Protein family

  • [SW|sodium:solute symporter (SSF) (TC 2.A.21) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|7E86EB6FF86F2C4AE3FD11DB8CE8E71696D94B1B|YodF]
  • Expression and Regulation

    Operons

    genes
    [gene|F093B021240236AA938C6336AA0B8DC37839F569|yhjC]-[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • repressed during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|12618455]
  • view in new tab

    Biological materials

    Mutant

  • GP2395 Δ[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]::tet available in [SW|Jörg Stülke]'s lab [pubmed|32743959]
  • MGNA-B283 (yhjB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1282 NBRP B. subtilis, Japan]
  • BKE10450 (Δ[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCATTCTGCTTCCTCCTT, downstream forward: _UP4_TAAGCATAAAAAAAGCAATC
  • BKK10450 (Δ[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCATTCTGCTTCCTCCTT, downstream forward: _UP4_TAAGCATAAAAAAAGCAATC
  • References

  • 11948146,22383849