SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


two-component response regulator, control of [gene|search|ydfJ ]expression
23.83 kDa
protein length
213 aa Sequence Blast
gene length
642 bp Sequence Blast
control of [gene|search|ydfJ ]expression
two-component response regulator

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    588,960 → 589,601

    The protein

    Paralogous protein(s)

  • [protein|23F365C23BDEE02D42C9355FC7D2A65DAF9F79ED|YxjL], [protein|387EF370CE24F7A3C20789A57329A02EBED46F53|LnrK], [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR], [protein|DD799ED3EB79457C27ED30C7B4DBBC2C8F962191|YhcZ]
  • [SW|Domains]

  • [SW|Response regulatory domain] (aa 3-118) (according to UniProt)
  • [SW|HTH luxR-type domain] (aa 142-207) (according to UniProt)
  • Modification

  • phosphorylation by [protein|C86BAEE3DC97A96EFB85A0E2DF44AD69ED04744C|YdfH] on an Asp residue
  • Structure

  • [PDB|5HEV] ([protein|search|LiaR ]from Enterococcus faecium, 37% identity) [pubmed|27670715]
  • [SW|Localization]

  • cytoplasma (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C148 (ydfI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05420 (Δ[gene|EFEAF09E4449A022A7323450FDED9458426A0080|ydfI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGATGGTCATCAACGATTA, downstream forward: _UP4_TAAACTGCATATTTGAAAAT
  • BKK05420 (Δ[gene|EFEAF09E4449A022A7323450FDED9458426A0080|ydfI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGATGGTCATCAACGATTA, downstream forward: _UP4_TAAACTGCATATTTGAAAAT
  • References

  • 10094672,15941986,27670715