SubtiBank SubtiBank
ydfI
The papers of the month are back! Check them out! Link here

ydfI

two-component response regulator, control of [gene|search|ydfJ ]expression
locus
BSU05420
pI
5.38
mw
23.83 kDa
protein length
213 aa Sequence Blast
gene length
639 bp Sequence Blast
function
control of [gene|search|ydfJ ]expression
product
two-component response regulator
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.1|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    Coordinates
    588,960 → 589,601

    The protein

    Paralogous protein(s)

  • [protein|23F365C23BDEE02D42C9355FC7D2A65DAF9F79ED|YxjL], [protein|387EF370CE24F7A3C20789A57329A02EBED46F53|LnrK], [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR], [protein|DD799ED3EB79457C27ED30C7B4DBBC2C8F962191|YhcZ]
  • Modification

  • phosphorylation by [protein|C86BAEE3DC97A96EFB85A0E2DF44AD69ED04744C|YdfH] on an Asp residue
  • Structure

  • [PDB|5HEV] ([protein|search|LiaR ]from Enterococcus faecium, 37% identity) [pubmed|27670715]
  • [SW|Localization]

  • cytoplasma (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|C86BAEE3DC97A96EFB85A0E2DF44AD69ED04744C|ydfH]-[gene|EFEAF09E4449A022A7323450FDED9458426A0080|ydfI]
    description
    [Pubmed|15941986]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C148 (ydfI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2146 NBRP B. subtilis, Japan]
  • BKE05420 (Δ[gene|EFEAF09E4449A022A7323450FDED9458426A0080|ydfI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGATGGTCATCAACGATTA, downstream forward: _UP4_TAAACTGCATATTTGAAAAT
  • BKK05420 (Δ[gene|EFEAF09E4449A022A7323450FDED9458426A0080|ydfI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGATGGTCATCAACGATTA, downstream forward: _UP4_TAAACTGCATATTTGAAAAT
  • References

  • 10094672,15941986,27670715