SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


membrane-bound chemotaxis receptor, methyl-accepting chemotaxis protein, acts also as pH sensor, responds to decreasing pH as an attractant signal
72.22 kDa
protein length
661 aa Sequence Blast
gene length
1986 bp Sequence Blast
control of chemotaxis, sensing of acidic enviromnents
methyl-accepting chemotaxis protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Signal transduction in motility and chemotaxis] → [category|SW|Membrane-bound chemoreceptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,206,169 → 3,208,154

    The protein

    Paralogous protein(s)

  • [protein|E4E1020B799A1B403BDB4847B91B02D64D161AF3|McpB], [protein|4CD44AD8FE68516C84889EAA2137828E06B8A30B|TlpB], [protein|1DE26CDEE952142C1303C822F0E2A63AE09F721B|TlpA], [protein|8333CD46F704F03A22482CAA98DEFCC945362A10|McpC]
  • [SW|Domains]

  • [SW|Cache domain] (aa 152-228) (according to UniProt)
  • [SW|HAMP domain] (aa 303-355) (according to UniProt)
  • [SW|Methyl-accepting transducer domain] (aa 374-610) (according to UniProt)
  • Modification

  • deamination of Gln-586, Gln-593, and Gln-594 (by [protein|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|CheD]) [Pubmed|22931217]
  • Structure

  • [PDB|6S1K] (from E. coli, corresponds to aa 291 ... 555, 31% identity) [pubmed|31925330]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711,21515776]
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8188684], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • additional information

  • in minimal medium, McpA is present with 15,900 +/- 3,000 molecules per cell [PubMed|21515776]
  • view in new tab

    Biological materials


  • BKE31240 (Δ[gene|F02E3080214A327E131ECDE0DBC52C57EFDFE2CE|mcpA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTCATTTCTCCTTTT, downstream forward: _UP4_TAATAAGCCTTAACACCCAA
  • BKK31240 (Δ[gene|F02E3080214A327E131ECDE0DBC52C57EFDFE2CE|mcpA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTCATTTCTCCTTTT, downstream forward: _UP4_TAATAAGCCTTAACACCCAA
  • References


  • 31792011
  • Original publications

  • 8251536,6137212,2105313,8188684,2505839,18763711,21515776,22931217,31685537,31925330