SubtiBank SubtiBank
yesN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yesN

two-component response regulator
locus
BSU_06960
pI
6.95
mw
40.50 kDa
protein length
368 aa Sequence Blast
gene length
1107 bp Sequence Blast
function
unknown
product
two-component response regulator
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.1|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    Coordinates
    760,452 → 761,558

    The protein

    Modification

  • phosphorylated on a Asp residue by [protein|4A0961B9B760D4AA968B750ECE634B13039F9FC5|YesM]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|EA17F9BBA4473C714711EB7577044402CD38B59C|yesL]-[gene|4A0961B9B760D4AA968B750ECE634B13039F9FC5|yesM]-[gene|F09661C8A483D0FC796204102021104A4373F895|yesN]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • MGNA-A946 (yesN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/946 NBRP B. subtilis, Japan]
  • BKE06960 (Δ[gene|F09661C8A483D0FC796204102021104A4373F895|yesN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAGCCAGCAGTATTTTAT, downstream forward: _UP4_TAGCCATCTCTGTTTTTTTG
  • BKK06960 (Δ[gene|F09661C8A483D0FC796204102021104A4373F895|yesN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAGCCAGCAGTATTTTAT, downstream forward: _UP4_TAGCCATCTCTGTTTTTTTG
  • References

  • 10094672