SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


two-component response regulator
40.50 kDa
protein length
368 aa Sequence Blast
gene length
1107 bp Sequence Blast
two-component response regulator

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    760,452 → 761,558

    The protein


  • [SW|Response regulatory domain] (aa 3-120) (according to UniProt)
  • [SW|HTH araC/xylS-type domain] (aa 259-361) (according to UniProt)
  • Modification

  • phosphorylated on a Asp residue by [protein|4A0961B9B760D4AA968B750ECE634B13039F9FC5|YesM]
  • Structure

  • [PDB|2JVJ] ([protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F], the [SW|Response regulatory domain], 28% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials


  • MGNA-A946 (yesN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE06960 (Δ[gene|F09661C8A483D0FC796204102021104A4373F895|yesN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAGCCAGCAGTATTTTAT, downstream forward: _UP4_TAGCCATCTCTGTTTTTTTG
  • BKK06960 (Δ[gene|F09661C8A483D0FC796204102021104A4373F895|yesN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAGCCAGCAGTATTTTAT, downstream forward: _UP4_TAGCCATCTCTGTTTTTTTG
  • References

  • 10094672