SubtiBank SubtiBank
yetJ
The papers of the month are back! Check them out! Link here

yetJ

pH-dependent calcium leak
locus
BSU07200
pI
9.14
mw
23.68 kDa
protein length
214 aa Sequence Blast
gene length
642 bp Sequence Blast
function
export of calcium, homeostasis
product
pH-dependent calcium leak
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW 1.3.1.4|Metal ion homeostasis/ Other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    787,992 → 788,636

    The protein

    Protein family

  • BI1 family (according to Swiss-Prot)
  • Structure

  • [PDB|4PGU] [Pubmed|24904158]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|F0A217DB65ED7A7539F775FEBC5D88718B4958BD|yetJ]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|1F2E7B30C04E8C58DDC3583A9C912BD480E979F7|yezD]-[gene|F0A217DB65ED7A7539F775FEBC5D88718B4958BD|yetJ]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16885442], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B461 (yetJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1460 NBRP B. subtilis, Japan]
  • BKE07200 (Δ[gene|F0A217DB65ED7A7539F775FEBC5D88718B4958BD|yetJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAAAAATCCTCCTAA, downstream forward: _UP4_GGCATTTTGAGCAGTGATGA
  • BKK07200 (Δ[gene|F0A217DB65ED7A7539F775FEBC5D88718B4958BD|yetJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAAAAATCCTCCTAA, downstream forward: _UP4_GGCATTTTGAGCAGTGATGA
  • References

  • 24904158,22383849