SubtiBank SubtiBank
yojN
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yojN

similar to nitric-oxide reductase
locus
BSU_19390
pI
4.95
mw
33.33 kDa
protein length
304 aa Sequence Blast
gene length
915 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.3|Anaerobic respiration/based on similarity]
  • Gene

    Coordinates
    2,113,764 → 2,114,678

    The protein

    Protein family

  • CbbQ/NirQ/NorQ/GpvN family (single member, according to UniProt)
  • Structure

  • [PDB|5C3C] (from Halothiobacillus neapolitanus, aa 70 - 304, 26% identity) [pubmed|26538283]
  • Expression and Regulation

    Operons

    genes
    [gene|F0C1FD1038E218AE73405F510F3AB4BF13D0A6BB|yojN]-[gene|7C906AE08767CD81305F9B0EB8491E1E4208262E|yojO]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B422 (yojN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1421 NBRP B. subtilis, Japan]
  • BKE19390 (Δ[gene|F0C1FD1038E218AE73405F510F3AB4BF13D0A6BB|yojN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCCATTAACGAGTAT, downstream forward: _UP4_CGAAATATTGCAGAAACTCTG
  • BKK19390 (Δ[gene|F0C1FD1038E218AE73405F510F3AB4BF13D0A6BB|yojN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCCATTAACGAGTAT, downstream forward: _UP4_CGAAATATTGCAGAAACTCTG
  • References

    Research papers

  • 26538283