SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


general stress protein, similar to magnesium transporter
37.55 kDa
protein length
317 aa Sequence Blast
gene length
954 bp Sequence Blast

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW|Metal ion homeostasis/ Other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,560,489 → 2,561,442

    The protein

    Catalyzed reaction/ biological activity

  • there is no indication for an implication of [protein|F0CACEFB53F4BC38DF77A38C4D78BA3DBE96E21A|CorA] in Mg2 uptake (based on mutant phenotypes, failure to complement mutants defective in Mg2 uptake) [Pubmed|24415722]
  • Protein family

  • CorA metal ion transporter (MIT) (TC 1.A.35) family (together with [protein|D281B88EC444F8175AB50FB2CD24B51F4E2C96F8|YfjQ]) (according to UniProt)
  • Structure

  • [PDB|5JTG] (from Themotoga maritima, C-terminal domain, aa 122-297, 28% identity)
  • [SW|Localization]

  • inner spore membrane [Pubmed|26731423]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials


  • MGNA-C473 (yqxL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE24740 (Δ[gene|F0CACEFB53F4BC38DF77A38C4D78BA3DBE96E21A|corA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAAGCTCCTCCAAAC, downstream forward: _UP4_TAGGATGTTTCATATTTTGT
  • BKK24740 (Δ[gene|F0CACEFB53F4BC38DF77A38C4D78BA3DBE96E21A|corA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAAGCTCCTCCAAAC, downstream forward: _UP4_TAGGATGTTTCATATTTTGT
  • References


  • 24079267
  • Original publications

  • 15231793,15856219,2507524,16267290,15805528,24415722,26731423