SubtiBank SubtiBank
secDF
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

secDF

preprotein translocase subunit (ATPase)
locus
BSU_27650
pI
9.52
mw
81.47 kDa
protein length
737 aa Sequence Blast
gene length
2214 bp Sequence Blast
function
protein secretion
product
preprotein translocase subunit (ATPase)
essential
no
synonyms
secF,secD

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,826,900 → 2,829,113

    Phenotypes of a mutant

  • reduced [SW|protein secretion] [pubmed|32111210]
  • The protein

    Protein family

  • N-terminal part: SecD/SecF family (single member, according to UniProt)
  • C-terminal part: SecD/SecF family (single member, according to UniProt)
  • Structure

  • [PDB|5XAN] (from Deinococcus radiodurans, 32% identity) [pubmed|28467902]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|F21A75744FA0B25D5A251CB57E7A7DC6ABFF1DC7|comN]-[gene|F0E7B6E000A5B06C9023C76F21551E754C8C45BA|secDF]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B519 (yrvB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1518 NBRP B. subtilis, Japan]
  • SM-GN3 (''secDF-spc''), available in [SW|Anne Galinier]'s and [SW|Boris Görke]'s labs
  • BKE27650 (Δ[gene|F0E7B6E000A5B06C9023C76F21551E754C8C45BA|secDF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGTATATCCTCCCTT, downstream forward: _UP4_TAAAAAATATCAGGCTGTCC
  • BKK27650 (Δ[gene|F0E7B6E000A5B06C9023C76F21551E754C8C45BA|secDF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGTATATCCTCCCTT, downstream forward: _UP4_TAAAAAATATCAGGCTGTCC
  • References

    Reviews

  • 25212246
  • Original publications

  • 18763711,15995216,18179421,28467902,32111210