SubtiBank SubtiBank
rbsC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rbsC

ribose ABC transporter (permease)
locus
BSU_35950
pI
10.31
mw
33.63 kDa
protein length
322 aa Sequence Blast
gene length
969 bp Sequence Blast
function
ribose uptake
product
ribose ABC transporter (permease)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.4|Utilization of ribose]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,705,165 → 3,706,133

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]-[gene|C229BD2C00B169CF4A99482E65B3F749AD9D51D8|rbsK]-[gene|F0E6F191FAF8F279462B09BF1FE4C6C752A57803|rbsD]-[gene|AB4A686F62550F90F5BD8D27DAADC9C33F1DA1DB|rbsA]-[gene|F1258E31151E137A850811B0C851D473CEFFD43B|rbsC]-[gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]
    description
    [Pubmed|7921236]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7511775], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7921236], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|7592460], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|7592460]
  • view in new tab

    Biological materials

    Mutant

  • BKE35950 (Δ[gene|F1258E31151E137A850811B0C851D473CEFFD43B|rbsC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTACCGCCCTCCCGTG, downstream forward: _UP4_AAGTCAGCTTAGGAGGGTTT
  • BKK35950 (Δ[gene|F1258E31151E137A850811B0C851D473CEFFD43B|rbsC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTACCGCCCTCCCGTG, downstream forward: _UP4_AAGTCAGCTTAGGAGGGTTT
  • References

  • 10092453,16872404,7511775,7592460,7921236