SubtiBank SubtiBank
narK
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

narK

nitrite extrusion protein
locus
BSU_37320
pI
10.10
mw
42.80 kDa
protein length
395 aa Sequence Blast
gene length
1188 bp Sequence Blast
function
nitrate respiration, nitrite export
product
nitrite extrusion protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.11|Other exporters]
  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.2|Anaerobic respiration]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,832,327 → 3,833,514

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • Nitrate/nitrite porter (TC 2.A.1.8) family (with [protein|2DE7BEC614129384779F4C761E0792385DECC563|NasA], according to UniProt)
  • Paralogous protein(s)

  • [protein|2DE7BEC614129384779F4C761E0792385DECC563|NasA]
  • Structure

  • [PDB|4JR9] (from E. coli, 25% identity) [pubmed|23665960]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|F14481DAA196868ACC1DE9EC8CBE593A2CBB6BE4|narK]-[gene|7165CC59CDAF64AAE2D591936860304A53BE5DF6|fnr]
    description
    [Pubmed|8846791]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8846791], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|EC6697D5D945B7E5083AFED9218748763C443278|NsrR]: repression, [Pubmed|16885456], in [regulon|EC6697D5D945B7E5083AFED9218748763C443278|NsrR regulon]
  • [protein|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr]: activation, [Pubmed|8846791,16428414], in [regulon|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr regulon]
  • regulation

  • ''[protein|search|fnr]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab

    Biological materials

    Mutant

  • BKE37320 (Δ[gene|F14481DAA196868ACC1DE9EC8CBE593A2CBB6BE4|narK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGCTTGCCCCTTTCA, downstream forward: _UP4_TAACACTGGGGCATTCACAA
  • BKK37320 (Δ[gene|F14481DAA196868ACC1DE9EC8CBE593A2CBB6BE4|narK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGCTTGCCCCTTTCA, downstream forward: _UP4_TAACACTGGGGCATTCACAA
  • References

    Reviews

  • 11289299
  • Original publications

  • 16885456,8846791,16428414,18763711,23665960