SubtiBank SubtiBank
yhdC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yhdC

unknown
locus
BSU_09360
pI
6.33
mw
12.21 kDa
protein length
107 aa Sequence Blast
gene length
324 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    1,011,427 → 1,011,750

    Expression and Regulation

    Operons

    genes
    [gene|F18E6AE974C42BE64D6334521444FAB94F83BF41|yhdC]
    description
    [Pubmed|22383849]

    regulation

  • expressed during [SW|sporulation] [Pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A691 (yhdC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/691 NBRP B. subtilis, Japan]
  • BKE09360 (Δ[gene|F18E6AE974C42BE64D6334521444FAB94F83BF41|yhdC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCAGTCTCCTGTA, downstream forward: _UP4_TAATAAAAAACTGTACAGCC
  • BKK09360 (Δ[gene|F18E6AE974C42BE64D6334521444FAB94F83BF41|yhdC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCAGTCTCCTGTA, downstream forward: _UP4_TAATAAAAAACTGTACAGCC