SubtiBank SubtiBank
yhdC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yhdC

unknown
locus
BSU_09360
pI
6.33
mw
12.21 kDa
protein length
107 aa Sequence Blast
gene length
324 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    1,011,427 → 1,011,750

    Expression and Regulation

    Operons

    genes
    [gene|F18E6AE974C42BE64D6334521444FAB94F83BF41|yhdC]
    description
    [Pubmed|22383849]

    regulation

  • expressed during [SW|sporulation] [Pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A691 (yhdC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/691 NBRP B. subtilis, Japan]
  • BKE09360 (Δ[gene|F18E6AE974C42BE64D6334521444FAB94F83BF41|yhdC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCAGTCTCCTGTA, downstream forward: _UP4_TAATAAAAAACTGTACAGCC
  • BKK09360 (Δ[gene|F18E6AE974C42BE64D6334521444FAB94F83BF41|yhdC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCAGTCTCCTGTA, downstream forward: _UP4_TAATAAAAAACTGTACAGCC