SubtiBank SubtiBank
mmgC

mmgC

acyl-CoA dehydrogenase
locus
BSU_24150
pI
8.52
mw
40.71 kDa
protein length
379 aa Sequence Blast
gene length
1140 bp Sequence Blast
function
mother cell metabolism
product
acyl-CoA dehydrogenase
essential
no
synonyms
yqiN

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,510,806 → 2,511,945

    The protein

    Catalyzed reaction/ biological activity

  • A + 2,3-saturated acyl-CoA --> 2,3-dehydroacyl-CoA + AH2 (according to UniProt)
  • Protein family

  • [SW|Acyl-CoA dehydrogenase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|6416197EF316D74998012765EF9819072C38D2E2|YotC], [protein|7D89BBB52403BF99416250688EFA90C2BE8EB591|AcdA], [protein|BA28DFBAF88A4994B0541D1FF2187312FDE1FA15|YngJ]
  • [protein|B5325CBF1408E2CA227EB462092E209F4C87E797|FadE]: (40.2%)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|3OWA] (from ''B. anthracis'', 39% identity, 55% similarity)
  • [PDB|4L1F] (from ''Acidaminococcus Fermentans'', 56% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|226100C0AC13BB345DB0F0F309DEB7F91F3770B0|mmgA]-[gene|FB95ABDC8557F26525E8B211595C130A7203ABC0|mmgB]-[gene|F25CDDEBAFC72036664323619F5197D45E86BE9A|mmgC]-[gene|3DB116F7423C31838ED6EE090B94DA5F93A4F40C|mmgD]-[gene|602EAB591A550F68C14F35F6E5F0A91C3B997343|mmgE]-[gene|2F4A025B8E3F14764D24CD7E33F7608C2EB1C42C|mmgF]
    description
    [Pubmed|8759838]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,8759838], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|8759838], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|15699190,8759838]
  • strongly expressed during oligotrophic growth [pubmed|30792386]
  • view in new tab

    Biological materials

    Mutant

  • BKE24150 (Δ[gene|F25CDDEBAFC72036664323619F5197D45E86BE9A|mmgC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTCGGCCACCCCCGGAT, downstream forward: _UP4_TGATAGACAAAAAACGCAAA
  • BKK24150 (Δ[gene|F25CDDEBAFC72036664323619F5197D45E86BE9A|mmgC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTCGGCCACCCCCGGAT, downstream forward: _UP4_TGATAGACAAAAAACGCAAA
  • References

  • 8759838,15699190,27766092