SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional activator of the [gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]-[gene|E26C70893C5D677C816C814558CC42F90B920087|manA]-[gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF] operon
75.13 kDa
protein length
648 aa Sequence Blast
gene length
1947 bp Sequence Blast
regulation of mannose utilization
transcriptional activator, PRD-type

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of mannose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|PRD-type regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    1,270,631 → 1,272,577

    The protein

    Catalyzed reaction/ biological activity

  • D-mannose + Nπ-phospho-L-histidyl-[protein] --> D-mannose 6-phosphate + L-histidyl-[protein] (according to UniProt)
  • Protein family

  • [SW|PRD-containing transcription factors]
  • Modification

  • phosphorylation by [protein|575CEC5C5C0458DC86A74F24654AC6990CB1E732|ManP] inactivates [protein|F273002AF97D87BB025B4F014C328C5592EAD621|ManR] (in the absence of mannose), phosphorylation by [gene|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] stimluates [protein|F273002AF97D87BB025B4F014C328C5592EAD621|ManR] [Pubmed|20139185]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20139185], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|F273002AF97D87BB025B4F014C328C5592EAD621|ManR]: activation, in the presence of mannose and absence of glucose [Pubmed|20139185], in [regulon|F273002AF97D87BB025B4F014C328C5592EAD621|ManR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by mannose ([protein|search|ManR]) [Pubmed|20139185]
  • view in new tab

    Biological materials


  • MGNA-A269 (yjdC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12000 (Δ[gene|F273002AF97D87BB025B4F014C328C5592EAD621|manR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTTTCTATCCTTC, downstream forward: _UP4_TAAAAGCAGGGATTATTCCT
  • BKK12000 (Δ[gene|F273002AF97D87BB025B4F014C328C5592EAD621|manR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTTTCTATCCTTC, downstream forward: _UP4_TAAAAGCAGGGATTATTCCT
  • References

  • 10627040,20139185,9663674,22900538,23551403