SubtiBank SubtiBank
manR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

manR

transcriptional activator of the [gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]-[gene|E26C70893C5D677C816C814558CC42F90B920087|manA]-[gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF] operon
locus
BSU_12000
pI
8.04
mw
75.13 kDa
protein length
648 aa Sequence Blast
gene length
1947 bp Sequence Blast
function
regulation of mannose utilization
product
transcriptional activator, PRD-type
essential
no
synonyms
yjdC

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.9|Utilization of mannose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.3|PRD-type regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    1,270,631 → 1,272,577

    The protein

    Catalyzed reaction/ biological activity

  • D-mannose + Nπ-phospho-L-histidyl-[protein] --> D-mannose 6-phosphate + L-histidyl-[protein] (according to UniProt)
  • Protein family

  • [SW|PRD-containing transcription factors]
  • Modification

  • phosphorylation by [protein|575CEC5C5C0458DC86A74F24654AC6990CB1E732|ManP] inactivates [protein|F273002AF97D87BB025B4F014C328C5592EAD621|ManR] (in the absence of mannose), phosphorylation by [gene|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] stimluates [protein|F273002AF97D87BB025B4F014C328C5592EAD621|ManR] [Pubmed|20139185]
  • Expression and Regulation

    Operons

    genes
    [gene|F273002AF97D87BB025B4F014C328C5592EAD621|manR]
    description
    [Pubmed|20139185]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20139185], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|F273002AF97D87BB025B4F014C328C5592EAD621|ManR]: activation, in the presence of mannose and absence of glucose [Pubmed|20139185], in [regulon|F273002AF97D87BB025B4F014C328C5592EAD621|ManR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by mannose ([protein|search|ManR]) [Pubmed|20139185]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A269 (yjdC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/269 NBRP B. subtilis, Japan]
  • BKE12000 (Δ[gene|F273002AF97D87BB025B4F014C328C5592EAD621|manR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTTTCTATCCTTC, downstream forward: _UP4_TAAAAGCAGGGATTATTCCT
  • BKK12000 (Δ[gene|F273002AF97D87BB025B4F014C328C5592EAD621|manR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTTTCTATCCTTC, downstream forward: _UP4_TAAAAGCAGGGATTATTCCT
  • References

  • 10627040,20139185,9663674,22900538,23551403