SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


legionaminic acid synthesis
40.73 kDa
protein length
373 aa Sequence Blast
gene length
1122 bp Sequence Blast
legionaminic acid synthesis

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of legionaminic acid (for spore crust))]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    3,887,741 → 3,888,862

    Phenotypes of a mutant

  • less hydrophobic spore surface [pubmed|32817102]
  • The protein

    Catalyzed reaction/ biological activity

  • required for spore crust assembly, legionaminic acid synthesis [pubmed|32817102]
  • [SW|Domains]

  • AFP-like domain (aa 305-367) (according to UniProt)
  • Structure

  • [PDB|1VLI]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|26577401], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|25239894,15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during [SW|sporulation] in the mother cell ([SW|SigE], [protein|search|SigK], [protein|search|GerE]) [Pubmed|26577401,25239894,15383836]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [ PubMed]
  • view in new tab

    Biological materials


  • BKE37870 (Δ[gene|F27921CD9B89EB16AA57ACECEDBF21ED383629F0|spsE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCGCGATCTGAAACGCTG, downstream forward: _UP4_ATTTTACTGAAGGACAGCCC
  • BKK37870 (Δ[gene|F27921CD9B89EB16AA57ACECEDBF21ED383629F0|spsE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCGCGATCTGAAACGCTG, downstream forward: _UP4_ATTTTACTGAAGGACAGCCC
  • References

  • 9353933,15383836,26577401,32817102