SubtiBank SubtiBank
lipL

lipL

N-amidotransferase, transfers lipoic acid from lipoyl-[protein|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|GcvH] to [protein|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|AcoC], [protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|BkdB], [protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|OdhB], and [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|PdhC], and from lipoyl-[protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|OdhB] to [protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|BkdB] and [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|PdhC]
locus
BSU_37640
pI
5.27
mw
31.27 kDa
protein length
281 aa Sequence Blast
gene length
846 bp Sequence Blast
function
lipoic acid metabolism
product
protein N-octanoyltransferase
essential
no
ec
2.3.1.204
synonyms
ipa-90d,ywfL

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.7|Biosynthesis and scavenging of lipoic acid]
  • Gene

    Coordinates
    3,863,415 → 3,864,260

    The protein

    Catalyzed reaction/ biological activity

  • transfers lipoic acid from lipoyl-[protein|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|GcvH] to [protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|BkdB], [protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|OdhB], and [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|PdhC], and from lipoyl-[protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|OdhB] to [protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|BkdB] and [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|PdhC] [pubmed|31066113]
  • [glycine-cleavage complex H protein]-N6-octanoyl-L-lysine + [lipoyl-carrier protein]-L-lysine --> [glycine-cleavage complex H protein]-L-lysine + [lipoyl-carrier protein]-N6-octanoyl-L-lysine (according to UniProt)
  • Protein family

  • Octanoyltransferase LipL family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|BPL/LPL catalytic domain] (aa 45-253) (according to UniProt)
  • Structure

  • [PDB|2P5I] (from ''Bacillus halodurans'', 56% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|F2E881F4BE0968C75BD75A5EFF4C7CA642034796|lipL]
    description
    [Pubmed|9353933]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B667 (ywfL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1666 NBRP B. subtilis, Japan]
  • BKE37640 (Δ[gene|F2E881F4BE0968C75BD75A5EFF4C7CA642034796|lipL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATGTAAAACCCTTTC, downstream forward: _UP4_TGAACGTTCTTCGCATGCCG
  • BKK37640 (Δ[gene|F2E881F4BE0968C75BD75A5EFF4C7CA642034796|lipL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATGTAAAACCCTTTC, downstream forward: _UP4_TGAACGTTCTTCGCATGCCG
  • References

    Reviews

  • 27074917
  • Original publications

  • 9353933,21338420,21338421,31066113