SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


N-amidotransferase, transfers lipoic acid from lipoyl-[protein|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|GcvH] to [protein|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|AcoC], [protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|BkdB], [protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|OdhB], and [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|PdhC], and from lipoyl-[protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|OdhB] to [protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|BkdB] and [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|PdhC]
31.27 kDa
protein length
281 aa Sequence Blast
gene length
846 bp Sequence Blast
lipoic acid metabolism
protein N-octanoyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis and scavenging of lipoic acid]
  • Gene

    3,863,415 → 3,864,260

    The protein

    Catalyzed reaction/ biological activity

  • transfers lipoic acid from lipoyl-[protein|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|GcvH] to [protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|BkdB], [protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|OdhB], and [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|PdhC], and from lipoyl-[protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|OdhB] to [protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|BkdB] and [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|PdhC] [pubmed|31066113]
  • [glycine-cleavage complex H protein]-N6-octanoyl-L-lysine + [lipoyl-carrier protein]-L-lysine --> [glycine-cleavage complex H protein]-L-lysine + [lipoyl-carrier protein]-N6-octanoyl-L-lysine (according to UniProt)
  • Protein family

  • Octanoyltransferase LipL family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|BPL/LPL catalytic domain] (aa 45-253) (according to UniProt)
  • Structure

  • [PDB|2P5I] (from ''Bacillus halodurans'', 56% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B667 (ywfL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37640 (Δ[gene|F2E881F4BE0968C75BD75A5EFF4C7CA642034796|lipL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATGTAAAACCCTTTC, downstream forward: _UP4_TGAACGTTCTTCGCATGCCG
  • BKK37640 (Δ[gene|F2E881F4BE0968C75BD75A5EFF4C7CA642034796|lipL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATGTAAAACCCTTTC, downstream forward: _UP4_TGAACGTTCTTCGCATGCCG
  • References


  • 27074917
  • Original publications

  • 9353933,21338420,21338421,31066113