SubtiBank SubtiBank
skfH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

skfH

unknown
locus
BSU_01980
pI
4.82
mw
16.08 kDa
protein length
141 aa Sequence Blast
gene length
426 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ybdE

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    219,607 → 220,032

    The protein

    [SW|Domains]

  • Thioredoxin domain (aa 2-141) (according to UniProt)
  • Structure

  • [PDB|2HYX] (from Mycobacterium tuberculosis, 33% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|DDB0022F50999AC52809D651C9CC5A5FDC71302C|skfA]-[gene|F981C605C652D1A4429579A5F24608CE7F570834|skfB]-[gene|4DFF9924E07D834F37580D73E88451C1671C5111|skfC]-[gene|5886364199844356446C08F08664B301A714E74A|skfE]-[gene|77D93CAEF46EBBB9BAF570714445E194D5F2884E|skfF]-[gene|527AB8EAAF0A1AAD4E5B714B35ED9F78BECC17EC|skfG]-[gene|F31B12F80AFC3580FD33811A1C22E74F75DC1A85|skfH]
    description
    [Pubmed|16816204]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16452424], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [PubMed|14651647,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|15687200,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|16816204], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [http://www.ncbi.nlm.nih.gov/sites/entrez/14651647,15687200 PubMed]
  • additional information

  • Northern blotting during during phosphate limitation showed an intense 0.25 kb '[protein|DDB0022F50999AC52809D651C9CC5A5FDC71302C|SkfA]'-specific transcript, and a weaker 6.5 kb [gene|DDB0022F50999AC52809D651C9CC5A5FDC71302C|skfA]-[gene|F981C605C652D1A4429579A5F24608CE7F570834|skfB]-[gene|4DFF9924E07D834F37580D73E88451C1671C5111|skfC]-[gene|5886364199844356446C08F08664B301A714E74A|skfE]-[gene|77D93CAEF46EBBB9BAF570714445E194D5F2884E|skfF]-[gene|527AB8EAAF0A1AAD4E5B714B35ED9F78BECC17EC|skfG]-[gene|F31B12F80AFC3580FD33811A1C22E74F75DC1A85|skfH] transcript
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B954 (ybdE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1953 NBRP B. subtilis, Japan]
  • BKE01980 (Δ[gene|F31B12F80AFC3580FD33811A1C22E74F75DC1A85|skfH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTTTCAGTCCTCCTTA, downstream forward: _UP4_TGAAATTTTCCGTCTTGTAT
  • BKK01980 (Δ[gene|F31B12F80AFC3580FD33811A1C22E74F75DC1A85|skfH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTTTCAGTCCTCCTTA, downstream forward: _UP4_TGAAATTTTCCGTCTTGTAT
  • References

    Reviews

  • 20955377
  • Original Publications

  • 12817086,16816204,14651647,15687200,15687200,17720793,27766092