SubtiBank SubtiBank
yazB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yazB

similar to transcription regulator ([SW|Xre family])
locus
BSU_00800
pI
6.59
mw
7.42 kDa
protein length
gene length
210 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    87,401 → 87,610

    The protein

    Protein family

  • [SW|Xre family]
  • [SW|Domains]

  • [SW|HTH cro/C1-type domain] (aa 10-64) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|B189AD3E3D18876E1956763182D835A151727392|pabB]-[gene|956E33AAAADB302EB8663E4B75C917242D3AD2C0|pabA]-[gene|865678B10097C40337F5EEA77FF0F6E7BF5358DC|pabC]-[gene|FA9539CB701BC47FD4E849FBA6D7B201B27C6104|sul]-[gene|AAE44B4F73C7C02F7DB3574B6169E0DE46F4B787|folB]-[gene|D2B189C6292ACE1B25658B407C284E9A683EAE5B|folK]-[gene|F373EBC35805DC551E8AFF6FDC7E43D5587C4700|yazB]-[gene|CE45D56BC413555AF4E7914B5307AD967A358452|yacF]-[gene|24CC89DE55B3C19F80B11D106B9FD241174AE3E4|lysS]
    description
    [Pubmed|9084182]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9084182], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • translation repressed by tryptophan ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|9084182]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B926 (yazB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1925 NBRP B. subtilis, Japan]
  • BKE00800 (Δ[gene|F373EBC35805DC551E8AFF6FDC7E43D5587C4700|yazB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAATCCTTCTTGAGTATAAC, downstream forward: _UP4_TAGAACAAATGAAAGGAGGA
  • BKK00800 (Δ[gene|F373EBC35805DC551E8AFF6FDC7E43D5587C4700|yazB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAATCCTTCTTGAGTATAAC, downstream forward: _UP4_TAGAACAAATGAAAGGAGGA
  • References

  • 9084182,23504016