SubtiBank SubtiBank
yazB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yazB

similar to transcription regulator ([SW|Xre family])
locus
BSU_00800
pI
6.59
mw
7.42 kDa
protein length
gene length
210 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    87,401 → 87,610

    The protein

    Protein family

  • [SW|Xre family]
  • [SW|Domains]

  • [SW|HTH cro/C1-type domain] (aa 10-64) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|B189AD3E3D18876E1956763182D835A151727392|pabB]-[gene|956E33AAAADB302EB8663E4B75C917242D3AD2C0|pabA]-[gene|865678B10097C40337F5EEA77FF0F6E7BF5358DC|pabC]-[gene|FA9539CB701BC47FD4E849FBA6D7B201B27C6104|sul]-[gene|AAE44B4F73C7C02F7DB3574B6169E0DE46F4B787|folB]-[gene|D2B189C6292ACE1B25658B407C284E9A683EAE5B|folK]-[gene|F373EBC35805DC551E8AFF6FDC7E43D5587C4700|yazB]-[gene|CE45D56BC413555AF4E7914B5307AD967A358452|yacF]-[gene|24CC89DE55B3C19F80B11D106B9FD241174AE3E4|lysS]
    description
    [Pubmed|9084182]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9084182], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • translation repressed by tryptophan ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|9084182]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B926 (yazB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1925 NBRP B. subtilis, Japan]
  • BKE00800 (Δ[gene|F373EBC35805DC551E8AFF6FDC7E43D5587C4700|yazB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAATCCTTCTTGAGTATAAC, downstream forward: _UP4_TAGAACAAATGAAAGGAGGA
  • BKK00800 (Δ[gene|F373EBC35805DC551E8AFF6FDC7E43D5587C4700|yazB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAATCCTTCTTGAGTATAAC, downstream forward: _UP4_TAGAACAAATGAAAGGAGGA
  • References

  • 9084182,23504016