SubtiBank SubtiBank
yvoE
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yvoE

putative glycerol-3-phosphatase (has been mis-annotated as HPr-P phosphatase)
locus
BSU_34970
pI
4.49
mw
23.86 kDa
protein length
216 aa Sequence Blast
gene length
651 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
hprP

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,591,810 → 3,592,460

    The protein

    Catalyzed reaction/ biological activity

  • glycerol-3-phosphate -→ glycerol + inorganic phosphate [Pubmed|22353596]
  • diphosphate + H2O --> H+ + 2 phosphate (according to UniProt)
  • Protein family

  • [SW|HAD superfamily] (according to UniProt)
  • Structure

  • [PDB|2YY6] (from Aquifex Aeolicus 36% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|771F205F818A755A661B8E1C95365A4F6AEB05C7|hprK]-[gene|2EB790AD1872ABCB57B784296C04C773AEA9C22B|lgt]-[gene|FA32AD908196BDA5C2C7C26EA08FB8416182CC3D|yvoD]-[gene|F3970DC380899E0505E80EB327AE27AFDE0F166F|yvoE]-[gene|C6B0EF2CD33D0F5455726167AE8F510619C3F6CA|yvoF]
    description
    [Pubmed|9465101]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23667565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A390 (yvoE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/390 NBRP B. subtilis, Japan]
  • GP852 (Δ[gene|F3970DC380899E0505E80EB327AE27AFDE0F166F|yvoE]::aphA3), available in [SW|Jörg Stülke]'s lab
  • GP851 (Δ([gene|2EB790AD1872ABCB57B784296C04C773AEA9C22B|lgt]-[gene|FA32AD908196BDA5C2C7C26EA08FB8416182CC3D|yvoD]-[gene|F3970DC380899E0505E80EB327AE27AFDE0F166F|yvoE]-[gene|C6B0EF2CD33D0F5455726167AE8F510619C3F6CA|yvoF])::aphA3), available in [SW|Jörg Stülke]'s lab
  • BKE34970 (Δ[gene|F3970DC380899E0505E80EB327AE27AFDE0F166F|yvoE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCGTCGTTACTTGTTTGT, downstream forward: _UP4_CAAATCGTTGGAGTGAAGTA
  • BKK34970 (Δ[gene|F3970DC380899E0505E80EB327AE27AFDE0F166F|yvoE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCGTCGTTACTTGTTTGT, downstream forward: _UP4_CAAATCGTTGGAGTGAAGTA
  • References

  • 22353596