SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


membrane protein, may be involved in manganese detoxification
35.38 kDa
protein length
324 aa Sequence Blast
gene length
972 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,410,654 → 1,411,628

    Expression and Regulation



    regulatory mechanism

  • [regulon|yybP-ykoY motif|yybP-ykoY motif]: antitermination, via riboswitch in the presence of the ligand Mn2+ [Pubmed|25794618], in [regulon|yybP-ykoY motif|yybP-ykoY motif]
  • regulation

  • induced in the presence of Mn2+ ([[yybP-ykoY motif]]) [Pubmed|25794618]
  • the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-A780 (ykoY::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13440 (Δ[gene|F39BC9CA68DD8E80D3ED021272A6F54EA9C57C7B|ykoY]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGGACGCTACTCCCC, downstream forward: _UP4_TAATCTGAAAGACTCTGCTT
  • BKK13440 (Δ[gene|F39BC9CA68DD8E80D3ED021272A6F54EA9C57C7B|ykoY]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGGACGCTACTCCCC, downstream forward: _UP4_TAATCTGAAAGACTCTGCTT
  • References

  • 15096624,25794618,25794619,29794222