SubtiBank SubtiBank
ykoY
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ykoY

membrane protein, may be involved in manganese detoxification
locus
BSU_13440
pI
9.73
mw
35.38 kDa
protein length
324 aa Sequence Blast
gene length
975 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,410,654 → 1,411,628

    The protein

    Protein family

  • [SW|TerC family] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|96CE303E9F757FBEBDEA5ADC8481697E2CD1361A|ykoX]-[gene|F39BC9CA68DD8E80D3ED021272A6F54EA9C57C7B|ykoY]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|F39BC9CA68DD8E80D3ED021272A6F54EA9C57C7B|ykoY]
    description
    [Pubmed|25794618]

    regulatory mechanism

  • [regulon|yybP-ykoY motif|yybP-ykoY motif]: antitermination, via riboswitch in the presence of the ligand Mn2+ [Pubmed|25794618], in [regulon|yybP-ykoY motif|yybP-ykoY motif]
  • regulation

  • induced in the presence of Mn2+ ([[yybP-ykoY motif]]) [Pubmed|25794618]
  • the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A780 (ykoY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/780 NBRP B. subtilis, Japan]
  • BKE13440 (Δ[gene|F39BC9CA68DD8E80D3ED021272A6F54EA9C57C7B|ykoY]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGGACGCTACTCCCC, downstream forward: _UP4_TAATCTGAAAGACTCTGCTT
  • BKK13440 (Δ[gene|F39BC9CA68DD8E80D3ED021272A6F54EA9C57C7B|ykoY]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGGACGCTACTCCCC, downstream forward: _UP4_TAATCTGAAAGACTCTGCTT
  • References

  • 15096624,25794618,25794619,29794222