SubtiBank SubtiBank
ydzV
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydzV

unknown, fragment of putative phage terminase
locus
BSU_06049
pI
0.00
mw
0.00 kDa
protein length
119 aa Sequence Blast
gene length
360 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.5|Prophage 3]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    654,333 → 654,692

    Biological materials

    Mutant

  • BKE06049 (Δ[gene|F3BE39EE646950D6269D63B66F28DFE36DE14D72|ydzV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06049 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCACTCCTACACGCCATG, downstream forward: _UP4_TAGAGCAAAGAAATAATCAA
  • BKK06049 (Δ[gene|F3BE39EE646950D6269D63B66F28DFE36DE14D72|ydzV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06049 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCACTCCTACACGCCATG, downstream forward: _UP4_TAGAGCAAAGAAATAATCAA