SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


two-component response regulator ([SW|OmpR family]), regulation of the ABC transporter [protein|8B4267532B9788AEB5EF39E2695C1FDA494C7055|YxdL]-[protein|4423383A3F6DAFDFA210F4BEEF7D8CBEC674DCEA|YxdM] in response to the cationic antimicrobial peptide, LL-37
26.45 kDa
protein length
229 aa Sequence Blast
gene length
690 bp Sequence Blast
resistance against toxic peptides
two-component response regulator ([SW|OmpR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    4,072,284 → 4,072,973

    The protein

    Protein family

  • [SW|OmpR family] of two-component response regulators
  • Modification

  • phosphorylated by [protein|F5BB96607452AC38ECF66923DB8758C364FE2F46|YxdK] on an Asp residue
  • Structure

  • [PDB|5DCL] (NisR from Streptococcus agalactiae, 41% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B702 (yxdJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39660 (Δ[gene|F3C5505E311E6DDABAFA87899F28CF6596CDBA63|yxdJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACTGAACCACTCCCGTT, downstream forward: _UP4_GGCTACCAGCTGAGGGCGCA
  • BKK39660 (Δ[gene|F3C5505E311E6DDABAFA87899F28CF6596CDBA63|yxdJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACTGAACCACTCCCGTT, downstream forward: _UP4_GGCTACCAGCTGAGGGCGCA
  • References

  • 10094672,17600057,10746760,15289557,21078927,21283517,23504016,26930060