SubtiBank SubtiBank
rplV
The papers of the month are back! Check them out! Link here

rplV

ribosomal protein
locus
BSU01210
pI
11.23
mw
12.32 kDa
protein length
113 aa Sequence Blast
gene length
339 bp Sequence Blast
function
translation
product
ribosomal protein L22 (BL17)
essential
yes
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    138,497 → 138,838

    Phenotypes of a mutant

  • essential [Pubmed|28189581]
  • The protein

    Protein family

  • [SW|ribosomal protein] L22P family (according to Swiss-Prot)
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • Expression and Regulation

    Operons

    genes
    [gene|751D0B909922D4D931FF3B2285CF142D966FCD48|rpsJ]-[gene|FEF94BD8482A41C493A8BEC3278B518E8BB4EDFE|rplC]-[gene|02F0893E814E00187D7B342990838EE5445CA78B|rplD]-[gene|5F3933197343FBBDCBD42B408837F8EEF0A0BEBD|rplW]-[gene|9445AC486A2B0A025030B275C789D227D5694145|rplB]-[gene|5287063586EB218843451386108E45274C7A8D68|rpsS]-[gene|F3DE42C41EF57DC5DFFF0D28129F2CE5DB781D99|rplV]-[gene|E7F4E01A6005C8469EAC64E8DFED96D0F29791A9|rpsC]-[gene|C5CAED1256F082E722EBA0A72647AA043B5681DB|rplP]-[gene|49B6E673E28CF21DF629B90A6AD453C46822BDB0|rpmC]-[gene|657A76B7786DC44861ECAC8FDFC8B4E8B55EF05F|rpsQ]-[gene|2BE91EEB70A1961D3BBE0603648E64E86CD0B708|rplN]-[gene|7E4159B8999B33370B12C18AFE2455507DEF891C|rplX]-[gene|F34C72BF4C3A8FF710D3B65F87324400ECDE3610|rplE]-[gene|0CC562884650F322298BEA28C889E2ABCB01AFDE|rpsN]-[gene|B50A96DCD3E8FB26BBC2819DA11A6E0B040C1C8E|rpsH]-[gene|20485A785D3AF82889F2018D3EA5B5FA33E64E95|rplF]-[gene|B39056862596254F3EC7AB2466B6FB3634621DF0|rplR]-[gene|144D952B05EBBFF41EC92DF906543EA00475FE69|rpsE]-[gene|87741B91E3081B7CC1C8AF275B38A52C066F018C|rpmD]-[gene|BEACD74FE0AE56E8154F3EB8D4247488030BF0D3|rplO]-[gene|5350DC618130E013757EE667B9AFC5F2EC68EC08|secY]-[gene|DD3A39A84E53A9B2ACBDD89DFAE3560E45C08DC1|adk]-[gene|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|map]-[gene|15EAA4007484D9F82CF4F402FF156165156FDDDE|ybzG]-[gene|BFAF497FB8E871AA84A0864CB08D2059791C7E73|infA]-[gene|F69B475C014087C6DEBE2F50F91862A623D21D1E|rpmJ]-[gene|C8B2EC9E35BDE4FC9B5642B8169F4BD13ACD30AC|rpsM]-[gene|8F83D1839E63016E2FA599A756A161DA5476D4D1|rpsK]-[gene|8B9957188874E9A20D2490730BA216F813D48F36|S56]-[gene|5996A5C25E108A3C4562686BF34A59CB14FD56EB|rpoA]-[gene|0D210B61B8F58DA21D97CFDE441501E31AB50D00|rplQ]
    description
    [Pubmed|9371452]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9371452] (two promoters, about 140bp and 200bp upstream of the start codon), in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • strongly repressed in response to glucose starvation in M9 medium [Pubmed|23033921]
  • additional information

  • term-seq has identified a potential novel regulatory RNA element (protein-dependent leader) including an intrinsic transcription terminator upstream of ''rpsJ'' [Pubmed|27120414]
  • view in new tab

    Biological materials

    Mutant

  • BKE01210 (Δ[gene|F3DE42C41EF57DC5DFFF0D28129F2CE5DB781D99|rplV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAAAAGCCTCCTCTCT, downstream forward: _UP4_TCAGAAAAGAAGGAGGGATA
  • References

  • 19653700,9371452,11948165,8635744,23002217,18288106,25903689,25903689,28189581