SubtiBank SubtiBank
phrI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

phrI

response regulator aspartate phosphatase (RapI) regulator
locus
BSU_05020
pI
8.91
mw
4.10 kDa
protein length
gene length
120 bp Sequence Blast
function
control of the transfer of the mobile genetic element ICEBs1
product
phosphatase (RapI) regulator
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.7|Control of transcription factor (other than two-component system)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.2|Mobile genetic elements] → [category|SW 5.2.1|ICEBs1]
  • [category|SW 6|Groups of genes] → [category|SW 6.8|Short peptides]
  • Gene

    Coordinates
    548,438 → 548,557

    The protein

    Catalyzed reaction/ biological activity

  • binds [protein|A208B4564A50D7BE2630DE40E8FAAF3C16236EE4|RapI] and inhibits its activity, this results in contiuned repression of the genes for the transfer of the mobile genetic element ICEBs1 by [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR] [Pubmed|17511812]
  • Protein family

  • [SW|phr family] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|A208B4564A50D7BE2630DE40E8FAAF3C16236EE4|rapI]-[gene|F3E14B772A5DA9073ED806A9ADDD9B64F0DFDD5B|phrI]
    description
    [Pubmed|11466295]

    sigma factors

  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|11466295], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11466295], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, [Pubmed|26582911], in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • regulation

  • induced at high cell density ([SW|ComA]) [Pubmed|26582911]
  • view in new tab

    genes
    [gene|F3E14B772A5DA9073ED806A9ADDD9B64F0DFDD5B|phrI]
    description
    [Pubmed|11466295]

    regulation

  • induced at high cell density ([SW|ComA]) [Pubmed|26582911]
  • view in new tab

    Biological materials

    Mutant

  • BKE05020 (Δ[gene|F3E14B772A5DA9073ED806A9ADDD9B64F0DFDD5B|phrI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTACTTAAAATCACTGCT, downstream forward: _UP4_TAGCTTAGATAATTGGAAAA
  • BKK05020 (Δ[gene|F3E14B772A5DA9073ED806A9ADDD9B64F0DFDD5B|phrI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTACTTAAAATCACTGCT, downstream forward: _UP4_TAGCTTAGATAATTGGAAAA
  • References

    Reviews

  • 24995588
  • Original publications

  • 11466295,17511812,26582911