SubtiBank SubtiBank
xylB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

xylB

xylulokinase
locus
BSU_17610
pI
6.46
mw
55.25 kDa
protein length
499 aa Sequence Blast
gene length
1500 bp Sequence Blast
function
utilization of xylan and xylose
product
xylulokinase
essential
no
ec
2.7.1.17
synonyms
yncA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.5|Utilization of xylan/ xylose]
  • Gene

    Coordinates
    1,893,396 → 1,894,895

    The protein

    Catalyzed reaction/ biological activity

  • ATP + D-xylulose --> ADP + D-xylulose 5-phosphate + H+ (according to UniProt)
  • Protein family

  • [SW|FGGY kinase family] (according to UniProt)
  • Structure

  • [PDB|2NLX] (from ''E. coli'', 35% identity, 52% similarity) [Pubmed|17123542]
  • Expression and Regulation

    Operons

    genes
    [gene|24829427B4518FE67038F194B54D4AAFAC64EF19|xylA]-[gene|F417A5B46CC7FC69DC8606A46D1AD5E41FA35B13|xylB]
    description
    [Pubmed|1921970]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2454911], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|8132469], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|AF4395D134485290F4AA307B48494FED39E52CD7|XylR]: repression, [Pubmed|2454911], in [regulon|AF4395D134485290F4AA307B48494FED39E52CD7|XylR regulon]
  • regulation

  • carbon catabolite repression ([protein|search|CcpA]) [Pubmed|8132469]
  • view in new tab

    Biological materials

    Mutant

  • GP1151 (del aphA3) available in [SW|Stülke] lab
  • 1A719 (no resistance), [Pubmed|1719948], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A719&Search=1A719 BGSC]
  • BKE17610 (Δ[gene|F417A5B46CC7FC69DC8606A46D1AD5E41FA35B13|xylB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCACTCCTTGCCC, downstream forward: _UP4_TAATGATGTTATTGTCTGGA
  • BKK17610 (Δ[gene|F417A5B46CC7FC69DC8606A46D1AD5E41FA35B13|xylB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCACTCCTTGCCC, downstream forward: _UP4_TAATGATGTTATTGTCTGGA
  • labs

  • [SW|Wolfgang Hillen], Erlangen University, Germany [http://www.biologie.uni-erlangen.de/mibi/index2.html Homepage]
  • References

  • 17123542,1921970,2454911,8132469