SubtiBank SubtiBank
yodU
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

yodU

N-terminal part of the split gene spsM (together with ypqP), spore envelope polysaccharide biosynthesis, in B. subtilis 168 the gene is disrupted by the SP-beta prophage
locus
BSU19810
pI
9.82
mw
15.00 kDa
protein length
141 aa Sequence Blast
gene length
423 bp Sequence Blast
function
spore envelope polysaccharide biosynthesis
product
unknown
essential
no
synonyms
ypqP,spsM

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,151,626 → 2,152,045

    The protein

    Paralogous protein(s)

  • [protein|5DB168A3D087AAEB003D7548A1A4356ABD07F712|EpsC] (for SpsM)
  • [SW|Domains]

  • SpsM: Polysacc_synt_2 domain (Pfam accession number, PF02719) in the 18–296-aa region [Pubmed|25299644]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|F42B27D5D7F3F39828940E377ABCC0730B25EA88|yodU]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN]: sigma factor, [Pubmed|25299644,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|25299644,15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during [SW|sporulation] in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|25299644,15383836]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A060 (yodU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/60 NBRP B. subtilis, Japan]
  • BKE19810 (Δ[gene|F42B27D5D7F3F39828940E377ABCC0730B25EA88|yodU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCTTATCCTCCAACTC, downstream forward: _UP4_GTATATTAAGATACTTACTA
  • BKK19810 (Δ[gene|F42B27D5D7F3F39828940E377ABCC0730B25EA88|yodU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCTTATCCTCCAACTC, downstream forward: _UP4_GTATATTAAGATACTTACTA
  • References

  • 25299644,15383836,25326298,28535266