SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


N-terminal part of the split gene spsM (together with ypqP), spore envelope polysaccharide biosynthesis, in B. subtilis 168 the gene is disrupted by the SP-beta prophage
15.00 kDa
protein length
141 aa Sequence Blast
gene length
423 bp Sequence Blast
spore envelope polysaccharide biosynthesis

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    2,151,626 → 2,152,045

    The protein

    Paralogous protein(s)

  • [protein|5DB168A3D087AAEB003D7548A1A4356ABD07F712|EpsC]:
  • [SW|Domains]

  • SpsM: Polysacc_synt_2 domain (Pfam accession number, PF02719) in the 18–296-aa region [Pubmed|25299644]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN]: sigma factor, [Pubmed|25299644,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|25299644,15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during [SW|sporulation] in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|25299644,15383836]
  • view in new tab

    Biological materials


  • MGNA-A060 (yodU::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19810 (Δ[gene|F42B27D5D7F3F39828940E377ABCC0730B25EA88|yodU]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCTTATCCTCCAACTC, downstream forward: _UP4_GTATATTAAGATACTTACTA
  • BKK19810 (Δ[gene|F42B27D5D7F3F39828940E377ABCC0730B25EA88|yodU]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCTTATCCTCCAACTC, downstream forward: _UP4_GTATATTAAGATACTTACTA
  • References

  • 25299644,15383836,25326298,28535266