SubtiBank SubtiBank
yodU
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yodU

5' part of the split gene [gene|240CD6EA3793821F5109252BDEF69C0120E454EF|ypqP] (together with [gene|240CD6EA3793821F5109252BDEF69C0120E454EF|ypqP]), spore envelope polysaccharide biosynthesis, in B. subtilis 168 the gene is disrupted by the [category|SW 5.1.2|SP-beta prophage]
locus
BSU19810
pI
9.82
mw
15.00 kDa
protein length
139 aa Sequence Blast
gene length
420 bp Sequence Blast
function
spore envelope polysaccharide biosynthesis
product
UDP-NAcGlcA inverting 4,6-dehydratase (N-terminal part)
essential
no
synonyms
ypqP,spsM

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,151,626 → 2,152,045

    The protein

    Paralogous protein(s)

  • [protein|5DB168A3D087AAEB003D7548A1A4356ABD07F712|EpsC]:
  • [SW|Domains]

  • SpsM: Polysacc_synt_2 domain (Pfam accession number, PF02719) in the 18–296-aa region [Pubmed|25299644]
  • Structure

  • [PDB|2GN4] (from Helicobacter pylori, 46% identity) [pubmed|16651261]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|F42B27D5D7F3F39828940E377ABCC0730B25EA88|yodU]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|25299644,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|25299644,15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during [SW|sporulation] in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|25299644,15383836]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A060 (yodU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/60 NBRP B. subtilis, Japan]
  • BKE19810 (Δ[gene|F42B27D5D7F3F39828940E377ABCC0730B25EA88|yodU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCTTATCCTCCAACTC, downstream forward: _UP4_GTATATTAAGATACTTACTA
  • BKK19810 (Δ[gene|F42B27D5D7F3F39828940E377ABCC0730B25EA88|yodU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCTTATCCTCCAACTC, downstream forward: _UP4_GTATATTAAGATACTTACTA
  • References

  • 25299644,15383836,25326298,28535266,16651261