SubtiBank SubtiBank
yebC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yebC

unknown
locus
BSU_06380
pI
9.57
mw
30.47 kDa
protein length
267 aa Sequence Blast
gene length
804 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    696,195 → 696,998

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|F4D5BD29C034D22F6F44DA0A0C0A778441F8BDD2|yebC]
    description
    [Pubmed|21815947]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • regulation

  • expression is reduced in a [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV] mutant [Pubmed|21926231]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A919 (yebC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/919 NBRP B. subtilis, Japan]
  • BKE06380 (Δ[gene|F4D5BD29C034D22F6F44DA0A0C0A778441F8BDD2|yebC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGCAACTCCTATCA, downstream forward: _UP4_TAATGAAAAAACCGGCTAAT
  • BKK06380 (Δ[gene|F4D5BD29C034D22F6F44DA0A0C0A778441F8BDD2|yebC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGCAACTCCTATCA, downstream forward: _UP4_TAATGAAAAAACCGGCTAAT
  • References

  • 21926231,21815947