SubtiBank SubtiBank
yocS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yocS

similar to sodium-dependent bile acid transporter
locus
BSU_19350
pI
10.18
mw
34.10 kDa
protein length
321 aa Sequence Blast
gene length
966 bp Sequence Blast
function
unknown
product
putative sodium-dependent transporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,106,490 → 2,107,455

    The protein

    Protein family

  • bile acid:sodium symporter (BASS) (TC 2.A.28) family (single member, according to UniProt)
  • Structure

  • [PDB|3ZUY] (from Neisseria meningitidis, 55% identity) [pubmed|21976025]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|F4EFFEA5B4622C3016121EF07114EEC5ED6C81D8|yocS]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B420 (yocS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1419 NBRP B. subtilis, Japan]
  • BKE19350 (Δ[gene|F4EFFEA5B4622C3016121EF07114EEC5ED6C81D8|yocS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACACTCCTAACAC, downstream forward: _UP4_TAAATATGCATCAAAAAGGG
  • BKK19350 (Δ[gene|F4EFFEA5B4622C3016121EF07114EEC5ED6C81D8|yocS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACACTCCTAACAC, downstream forward: _UP4_TAAATATGCATCAAAAAGGG
  • References

  • 18763711,21976025