SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional regulator ([SW|DeoR family]) of the [gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]-[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]-[gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]-[gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]-[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA] operon
28.70 kDa
protein length
258 aa Sequence Blast
gene length
777 bp Sequence Blast
control of rhamnose utilization
transcriptional regulator ([SW|DeoR family])

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of rhamnose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    3,201,027 → 3,201,803

    The protein

    Effectors of protein activity

  • molecular inducer: rhamnulose-1-phosphate [Pubmed|26712933]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|26712933], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|F574142C1E61788FF8F4B61280AD4F87292D08DF|RhaR]: repression, [Pubmed|26712933], in [regulon|F574142C1E61788FF8F4B61280AD4F87292D08DF|RhaR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|26712933], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expression during spore [SW|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab



  • expression during spore [SW|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • MGNA-B546 (yulB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE31210 (Δ[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGTAACGCCCTTCCTC, downstream forward: _UP4_CCTCTTTCGAAGAGAGGGTG
  • BKK31210 (Δ[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGTAACGCCCTTCCTC, downstream forward: _UP4_CCTCTTTCGAAGAGAGGGTG
  • References

  • 26712933,24391637,22383849