SubtiBank SubtiBank
lplJ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

lplJ

lipoate-protein ligase
locus
BSU_10250
pI
5.84
mw
37.86 kDa
protein length
331 aa Sequence Blast
gene length
996 bp Sequence Blast
function
scavenging of lipoic acid
product
Lipoate:protein ligase
essential
no
synonyms
yhfJ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.7|Biosynthesis and scavenging of lipoic acid]
  • Gene

    Coordinates
    1,099,159 → 1,100,154

    The protein

    Catalyzed reaction/ biological activity

  • attaches exogenous lipoic acid to the apoproteins by a two-step ATP dependent reaction:
  • a) the activation of lipoic acid to lipoyl-AMP [pubmed|27074917]
  • b) the transfer of this activated lipoyl species to E2 subunit of 2-oxoglutarate dehydrogenase ([protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|OdhB]) and [protein|58CF62EBA28E77668A0B5319142C8AC20D81CD8A|GcvH], with the concomitant liberation of AMP [pubmed|31066113,27074917]
  • (R)-lipoate + [lipoyl-carrier protein]-L-lysine + ATP --> [lipoyl-carrier protein]-(R)-N6-lipoyl-L-lysine + AMP + diphosphate + H+ (according to UniProt)
  • Protein family

  • LplA family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|BPL/LPL catalytic domain] (aa 27-214) (according to UniProt)
  • Structure

  • [PDB|5IBY] (from Enterococcus faecalis, 59% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|8FA225FA26DB0B89812A835EB928F2C8892EBC89|yhfI]-[gene|F68611DF326880FCCB4EE3C2B364ECCC3DEAD78D|lplJ]-[gene|2DA0641FA6EC81072DA585D65FE17B7E5A010AC9|yhfK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B276 (yhfJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1275 NBRP B. subtilis, Japan]
  • BKE10250 (Δ[gene|F68611DF326880FCCB4EE3C2B364ECCC3DEAD78D|lplJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATAAATAACATGGTGCTCC, downstream forward: _UP4_TAAGGCAAAACACATCGTTT
  • BKK10250 (Δ[gene|F68611DF326880FCCB4EE3C2B364ECCC3DEAD78D|lplJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATAAATAACATGGTGCTCC, downstream forward: _UP4_TAAGGCAAAACACATCGTTT
  • References

    Reviews

  • 27074917
  • Original publications

  • 21338420,21338421,31066113