SubtiBank SubtiBank
yqeZ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqeZ

NfeD family protein NfeD1b, resistence protein (against sublancin), accessory role in resistance to cefuroxime
locus
BSU_25390
pI
5.64
mw
46.30 kDa
protein length
437 aa Sequence Blast
gene length
1314 bp Sequence Blast
function
resistance against sublancin
product
NfeD family protein NfeD1b, serine protease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,618,466 → 2,619,779

    The protein

    Protein family

  • NfeD family (with [protein|FFBB9B236B7D532D45FE0593B793E28E051BE7A2|YuaF])
  • [SW|Localization]

  • forms patch-like structures all around in the cell membrane [Pubmed|22753055]
  • Expression and Regulation

    Operons

    genes
    [gene|F6B0D27B434D81B7A680555E4457F266B6206B7D|yqeZ]-[gene|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|floA]-[gene|A80317C3B8DF06E2187E02A05C13845508C18B40|yqfB]
    description
    [Pubmed|11866510]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • expressed under stress conditions ([protein|search|SigW]) [Pubmed|11866510]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C446 (yqeZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2444 NBRP B. subtilis, Japan]
  • BKE25390 (Δ[gene|F6B0D27B434D81B7A680555E4457F266B6206B7D|yqeZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGGCGGTGTATCCCTCC, downstream forward: _UP4_TAAATAGAAACGAGGAGAAG
  • BKK25390 (Δ[gene|F6B0D27B434D81B7A680555E4457F266B6206B7D|yqeZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGGCGGTGTATCCCTCC, downstream forward: _UP4_TAAATAGAAACGAGGAGAAG
  • References

  • 16629676,11866510,22753055