SubtiBank SubtiBank
gcvT

gcvT

aminomethyltransferase (glycine cleavage system protein T)
locus
BSU_24570
pI
5.73
mw
39.62 kDa
protein length
362 aa Sequence Blast
gene length
1089 bp Sequence Blast
function
glycine utilization
product
aminomethyltransferase (glycine cleavage system protein T)
essential
no
ec
2.1.2.10
synonyms
yqhI

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.8|Utilization of threonine/ glycine]
  • Gene

    Coordinates
    2,548,245 → 2,549,333

    The protein

    Catalyzed reaction/ biological activity

  • (6S)-5,6,7,8-tetrahydrofolate + (R)-N6-(S8-aminomethyldihydrolipoyl)-L-lysyl-[protein] --> (6R)-5,10-methylene-5,6,7,8-tetrahydrofolate + (R)-N6-dihydrolipoyl-L-lysyl-[protein] + NH4+ (according to UniProt)
  • Protein family

  • gcvT family (single member, according to UniProt)
  • [SW|Cofactors]

  • tetrahydrofolate
  • Structure

  • [PDB|1YX2]
  • Expression and Regulation

    Operons

    genes
    [gene|F6F449170276055E6D60D89E9E17A152A82CA166|gcvT]-[gene|DB0618EBA12013842ED3972165D0276F438D8EC1|gcvPA]-[gene|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|gcvPB]
    description
    [Pubmed|15472076]

    regulatory mechanism

  • [regulon|Gly-box|Gly-box]: termination, in [regulon|Gly-box|Gly-box]
  • regulation

  • induced by glycine [Pubmed|15472076]
  • the [SW|Gly-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C428 (yqhI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2426 NBRP B. subtilis, Japan]
  • BKE24570 (Δ[gene|F6F449170276055E6D60D89E9E17A152A82CA166|gcvT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAATTCCTCCCCTTTA, downstream forward: _UP4_TAATATTTTTTCTTGGAGAG
  • BKK24570 (Δ[gene|F6F449170276055E6D60D89E9E17A152A82CA166|gcvT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAATTCCTCCCCTTTA, downstream forward: _UP4_TAATATTTTTTCTTGGAGAG
  • lacZ fusion

  • pGP431 (in [SW|pAC7]), available in [SW|Stülke] lab
  • References

  • 15096624,15472076,23249744,23721735,29794222,29089431