SubtiBank SubtiBank
ycgA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ycgA

unknown
locus
BSU_03020
pI
8.24
mw
41.37 kDa
protein length
477 aa Sequence Blast
gene length
1434 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    325,339 → 326,772

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|F71FBBE4436FBC4221C3631794C73D306CD3FC7E|ycgA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [Pubmed|12618455]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B987 (ycgA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1986 NBRP B. subtilis, Japan]
  • BKE03020 (Δ[gene|F71FBBE4436FBC4221C3631794C73D306CD3FC7E|ycgA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTCGATCCATCCCCT, downstream forward: _UP4_TAACGATTGCTGCCCGCCGG
  • BKK03020 (Δ[gene|F71FBBE4436FBC4221C3631794C73D306CD3FC7E|ycgA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTCGATCCATCCCCT, downstream forward: _UP4_TAACGATTGCTGCCCGCCGG
  • References

  • 12884008,12618455,12618455