SubtiBank SubtiBank
yczL
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yczL

unknown
locus
BSU_03359
pI
10.29
mw
6.70 kDa
protein length
gene length
186 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    365,850 → 366,035

    Expression and Regulation

    Operons

    genes
    [gene|F735802BB483C2C5437240AB2E9FC340EAA5B353|yczL]-[gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA]
    description
    [Pubmed|25649915]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12426338], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]: repression, in the presence of zinc [Pubmed|12426338], in [regulon|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur regulon]
  • view in new tab

    genes
    [gene|93380E8EEB672C14C9BE2B5A6D8573FBCA149514|folEB]-[gene|456AF184261976FAA73359E81443F7035F457D07|yciB]-[gene|F735802BB483C2C5437240AB2E9FC340EAA5B353|yczL]-[gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA]
    description
    [Pubmed|9811636]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12426338], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]: repression, in the presence of zinc [Pubmed|12426338], in [regulon|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur regulon]
  • regulation

  • [SW|folE2]: induced by zinc starvation ([protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]) [Pubmed|12426338]
  • view in new tab

    Biological materials

    Mutant

  • BKE03359 (Δ[gene|F735802BB483C2C5437240AB2E9FC340EAA5B353|yczL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03359 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGATGCACAGACAATGA, downstream forward: _UP4_TAATCATTCTATTTTAATGG
  • BKK03359 (Δ[gene|F735802BB483C2C5437240AB2E9FC340EAA5B353|yczL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03359 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGATGCACAGACAATGA, downstream forward: _UP4_TAATCATTCTATTTTAATGG