SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


pyruvate kinase, glycolytic enzyme
62.00 kDa
protein length
585 aa Sequence Blast
gene length
1758 bp Sequence Blast
catabolic enzyme in glycolysis
pyruvate kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Glycolysis]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    2,984,788 → 2,986,545

    Phenotypes of a mutant

  • unable to grow with non-[protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] carbohydrates (such as glucitol or glycerol) as single carbon source
  • suppression of ''[gene|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ]''(ts) mutation (reverted by addition of pyruvate) [Pubmed|24825009]
  • The protein

    Catalyzed reaction/ biological activity

  • ADP + phosphoenolpyruvate → ATP + pyruvate
  • The reaction is irreversible under physiological conditions
  • Protein family

  • C-terminal part: [SW|PEP-utilizing enzyme family] (according to UniProt)
  • pyruvate kinase family (single member, according to UniProt)
  • Modification

  • phosphorylation on Ser36 [Pubmed|17218307], [Pubmed|16493705], phosphorylation on Ser536 or Ser546 [Pubmed|17726680], please note that the Ser is not on position 536 but rather at 538
  • [SW|Cofactors]

  • Mg2+, K+
  • Effectors of protein activity

  • Activated by PEP (Hill Coefficient 1,8) [Pubmed|4623707] [Pubmed|3711058]
  • Allosterically activated by AMP [Pubmed|3711058]
  • Activation by r5p and ADP [Pubmed|3711058]
  • Inhibition by ADP and f16bp in high concentrations; and ATP [Pubmed|3711058]
  • Structure

  • [PDB|2E28] (Geobacillus stearothermophilus) [pubmed|18511452]
  • [SW|Localization]

  • cytoplasm [Pubmed|16479537]
  • Additional information

  • The enzyme is a tetramer with four active sites [Pubmed|3711058]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation




  • twofold induced by glucose [Pubmed|11489127]
  • view in new tab

    Biological materials


  • GP589 (''pyk''::''cat''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]
  • GP600 (''pyk''::''erm''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]
  • GP1745: BSB1 ''pyk::aphA3'', available in [SW|Jörg Stülke]' lab
  • BKE29180 (Δ[gene|F76A03A71DADC32C7166E37B994EFED019FDF8A4|pyk]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTTCACTTCCTTCT, downstream forward: _UP4_TAATTACAGGTGAAAATGGA
  • BKK29180 (Δ[gene|F76A03A71DADC32C7166E37B994EFED019FDF8A4|pyk]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTTCACTTCCTTCT, downstream forward: _UP4_TAATTACAGGTGAAAATGGA
  • Expression vectors

  • expression in ''E. coli'', N-terminal His-tag: pGP1100 (in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab, [pubmed|20389117]
  • expression in ''B. subtilis'', native protein: pGP1411 (in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
  • expression in ''B. subtilis'', N-terminal Strep-tag: pGP1409 (in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • expression in ''B. subtilis'', C-terminal Strep-tag: pGP1410 (in [SW|pGP382]), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • see ''[gene|A7E31A5EBCF343B3A841E5F6E9CDE3CA5D1622EB|pfkA]
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]
  • labs

  • [SW|Jörg Stülke], University of Göttingen, Germany [ Homepage]
  • References

  • 17726680,16493705,11489127,17505547,10966427,17218307,3711058,4623707,21821766,22846916,23420519,24158146,24571712,15378759,24825009,28516784,18511452,31590319