The second international online conference
#Subtillery2021 will be held 14th - 18th June - save the date, for more information see the
conference website!
The 21st
International Conference on Bacilli has been postponed to 2022 and will take place in Prague.
pyruvate kinase, glycolytic enzyme
function
catabolic enzyme in glycolysis
Genomic Context
categories
[category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.1|Glycolysis][category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]Gene
Coordinates
2,984,788 → 2,986,545
Phenotypes of a mutant
unable to grow with non-[protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] carbohydrates (such as glucitol or glycerol) as single carbon sourcesuppression of ''[gene|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ]''(ts) mutation (reverted by addition of pyruvate) [Pubmed|24825009]The protein
Catalyzed reaction/ biological activity
ADP + phosphoenolpyruvate → ATP + pyruvateThe reaction is irreversible under physiological conditionsProtein family
C-terminal part: [SW|PEP-utilizing enzyme family] (according to UniProt)pyruvate kinase family (single member, according to UniProt)Modification
phosphorylation on Ser36 [Pubmed|17218307], [Pubmed|16493705], phosphorylation on Ser536 or Ser546 [Pubmed|17726680], please note that the Ser is not on position 536 but rather at 538[SW|Cofactors]
Mg2+, K+Effectors of protein activity
Activated by PEP (Hill Coefficient 1,8) [Pubmed|4623707] [Pubmed|3711058]Allosterically activated by AMP [Pubmed|3711058]Activation by r5p and ADP [Pubmed|3711058]Inhibition by ADP and f16bp in high concentrations; and ATP [Pubmed|3711058]Structure
[PDB|2E28] (Geobacillus stearothermophilus) [pubmed|18511452][SW|Localization]
cytoplasm [Pubmed|16479537]Additional information
The enzyme is a tetramer with four active sites [Pubmed|3711058]belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]Expression and Regulation
Operons
genes
[gene|A7E31A5EBCF343B3A841E5F6E9CDE3CA5D1622EB|pfkA]-[gene|F76A03A71DADC32C7166E37B994EFED019FDF8A4|pyk]-[gene|1C6D935B36416327FE63CABC53440441E8563D7E|ytzA]
description
[Pubmed|11489127]
regulation
twofold induced by glucose [Pubmed|11489127]view in new tabBiological materials
Mutant
GP589 (''pyk''::''cat''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]GP600 (''pyk''::''erm''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]GP1745: BSB1 ''pyk::aphA3'', available in [SW|Jörg Stülke]' labBKE29180 (Δ[gene|F76A03A71DADC32C7166E37B994EFED019FDF8A4|pyk]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTTCACTTCCTTCT, downstream forward: _UP4_TAATTACAGGTGAAAATGGABKK29180 (Δ[gene|F76A03A71DADC32C7166E37B994EFED019FDF8A4|pyk]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTTCACTTCCTTCT, downstream forward: _UP4_TAATTACAGGTGAAAATGGAExpression vectors
expression in ''E. coli'', N-terminal His-tag: pGP1100 (in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab, [pubmed|20389117]expression in ''B. subtilis'', native protein: pGP1411 (in [SW|pBQ200]), available in [SW|Jörg Stülke]'s labexpression in ''B. subtilis'', N-terminal Strep-tag: pGP1409 (in [SW|pGP380]), available in [SW|Jörg Stülke]'s labexpression in ''B. subtilis'', C-terminal Strep-tag: pGP1410 (in [SW|pGP382]), available in [SW|Jörg Stülke]'s lablacZ fusion
see ''[gene|A7E31A5EBCF343B3A841E5F6E9CDE3CA5D1622EB|pfkA]two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]labs
[SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]References
17726680,16493705,11489127,17505547,10966427,17218307,3711058,4623707,21821766,22846916,23420519,24158146,24571712,15378759,24825009,28516784,18511452,31590319