SubtiBank SubtiBank
resA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

resA

extracytoplasmic thioredoxin, cytochrome c biogenesis, reduces disulfide bonds in apo-cytochrome prior to the attachment of heme
locus
BSU_23150
pI
8.37
mw
20.76 kDa
protein length
179 aa Sequence Blast
gene length
540 bp Sequence Blast
function
cytochrome c biogenesis
product
extracytoplasmic thioredoxin
essential
no
synonyms
ypxA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.4|Respiration/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,420,804 → 2,421,343

    Phenotypes of a mutant

  • essential according to [http://www.ncbi.nlm.nih.gov/pubmed/12682299 Kobayashi et al.], but inactivation of ''resA'' was reported by [http://www.ncbi.nlm.nih.gov/pubmed/12637552 Erlendsson et al.] and by [http://www.ncbi.nlm.nih.gov/pubmed/26735940 Meeske et al. ]
  • inactivation of ''[gene|F7D869F77E2275110737EF658C58FA1BF742D73F|resA]'' reduces sporulation efficiency to 45.6% that of wild type cells; delayed entry into sporulation [Pubmed|26735940]
  • The protein

    Protein family

  • [SW|Thioredoxin family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|0B299F9459023306FA91298A6162A09E4A87C3B2|StoA], [protein|50BBC8AB77B99B9FE5B8A8FE906D39DFEA4ED652|YneN]
  • [SW|Domains]

  • [SW|Thioredoxin domain] (aa 36-174) (according to UniProt)
  • Structure

  • [PDB|3C73]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|5CD1E266B0EC82546A2AF19A05490DD4D04F812C|rluB]-[gene|F7D869F77E2275110737EF658C58FA1BF742D73F|resA]-[gene|495721E4B8BF6FEC01E62E86339560F90776EED1|resB]-[gene|97FE84CF968596AC39D19EE2E43DA625147FD702|resC]-[gene|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]-[gene|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|resE]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|F7D869F77E2275110737EF658C58FA1BF742D73F|resA]-[gene|495721E4B8BF6FEC01E62E86339560F90776EED1|resB]-[gene|97FE84CF968596AC39D19EE2E43DA625147FD702|resC]-[gene|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]-[gene|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|resE]
    description
    [Pubmed|8631715]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8631715], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [PubMed|8631715,11222591], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|9988472], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|16825793], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [http://www.ncbi.nlm.nih.gov/sites/entrez/8631715,11222591 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • BKE23150 (Δ[gene|F7D869F77E2275110737EF658C58FA1BF742D73F|resA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTCCACTGCCCCCTTC, downstream forward: _UP4_ATAAAACCCGGAGAGACTTC
  • BKK23150 (Δ[gene|F7D869F77E2275110737EF658C58FA1BF742D73F|resA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTCCACTGCCCCCTTC, downstream forward: _UP4_ATAAAACCCGGAGAGACTTC
  • References

  • 8631715,18422485,18456809,8631715,11222591,9988472,16825793,16971393,12637552,26735940