SubtiBank SubtiBank
resQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

resQ

release factor-dependent ribosome rescue factor
locus
BSU_23540
pI
11.38
mw
7.95 kDa
protein length
gene length
216 bp Sequence Blast
function
resolution of stalled translation complexes
product
ribosome rescue factor
essential
no
synonyms
yqkK

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.12|Translation/ other]
  • Gene

    Coordinates
    2,451,148 → 2,451,363

    Phenotypes of a mutant

  • essential in the absence of trans-translation ([gene|5C12BB19B975F7FEBCFA119DAC66338C20FCECFA|ssrA], [gene|D19519B5A776D6E8EC2BFE7A7D67469CA0A6459A|smpB]) [https://www.biorxiv.org/content/biorxiv/early/2019/08/15/732420.full.pdf reference]
  • Biological materials

    Mutant

  • MGNA-C457 (yqkK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2455 NBRP B. subtilis, Japan]
  • BKE23540 (Δ[gene|F7F780D11A6B11EB62CFA5202D1243A381AB40E1|resQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGATCACTCCCTTTTT, downstream forward: _UP4_TAGCATTCATCTCTATTGTT
  • BKK23540 (Δ[gene|F7F780D11A6B11EB62CFA5202D1243A381AB40E1|resQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGATCACTCCCTTTTT, downstream forward: _UP4_TAGCATTCATCTCTATTGTT