SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional repressor of genes expressed in the transition phase
23.57 kDa
protein length
203 aa Sequence Blast
gene length
612 bp Sequence Blast
transition state regulator
transcriptional repressor ([SW|MarR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.6|Transition state regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    1,073,106 → 1,073,717

    The protein


  • phosphorylated on Arg-3 [Pubmed|22517742]
  • Effectors of protein activity

  • activity is inhibited in an unknown way by [protein|83F1BE86A7AE1098C1319198A8DDA6B8C5F49236|PrkA] (possibly phosphorylation) [Pubmed|25983726]
  • Structure

  • [PDB|2FXA]
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19251843], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|2504584], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|69D55899C7CE30A282AF6011527FAD55A76CDBDA|SenS]: positive regulation, in [regulon|69D55899C7CE30A282AF6011527FAD55A76CDBDA|SenS regulon]
  • [protein|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|SalA]: negative regulation, in [regulon|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|SalA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: negative regulation, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|2504584]
  • view in new tab

    Biological materials


  • 1A918 ( ''scoC''::''erm trpC2 leuC7''), [Pubmed|15126467], available at the [ Bacillus Genetic Stock Center]
  • BKE09990 (Δ[gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGTCACCTGCTTCTC, downstream forward: _UP4_GAAGAGCTCGAACCTGTAAA
  • BKK09990 (Δ[gene|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGTCACCTGCTTCTC, downstream forward: _UP4_GAAGAGCTCGAACCTGTAAA
  • Expression vectors

  • for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Gerth lab
  • References


  • 28886686
  • Original publications

  • 3131303,16923912,1906467,10383984,16321961,14629015,1907636,15126467,2504584,15104138,19118355,19801406,19898538,20382764,22517742,23660663,11717292,25966844,19251843,26473603,25983726,26728191,31039790