SubtiBank SubtiBank
yvzA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yvzA

unknown
locus
BSU_34830
pI
9.78
mw
13.66 kDa
protein length
119 aa Sequence Blast
gene length
360 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,579,679 → 3,580,038

    Expression and Regulation

    Operons

    genes
    [gene|3D57D86B076CE5975C5A2516A6D26AEEFD143A55|yvcA]-[gene|56A098AF47D293AA2EC6E7E7EC2626A832BA51CD|yvcB]-[gene|F83570E87B0B3C09A17ECC60365EDF9B448C490F|yvzA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18978066], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|17590234], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B646 (yvzA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1645 NBRP B. subtilis, Japan]
  • BKE34830 (Δ[gene|F83570E87B0B3C09A17ECC60365EDF9B448C490F|yvzA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGAAGTCACTCTTCATATTC, downstream forward: _UP4_TAACACAAAAATCTCCTATT
  • BKK34830 (Δ[gene|F83570E87B0B3C09A17ECC60365EDF9B448C490F|yvzA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGAAGTCACTCTTCATATTC, downstream forward: _UP4_TAACACAAAAATCTCCTATT
  • References

  • 18978066,17590234