SubtiBank SubtiBank
spsL
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

spsL

dTDP -4-dehydrorhamnose-3,5-epimerase
locus
BSU_37810
pI
4.88
mw
17.54 kDa
protein length
151 aa Sequence Blast
gene length
456 bp Sequence Blast
function
rhamnose biosynthesis, spore crust polysaccharide synthesis
product
dTDP -4-dehydrorhamnose-3,5-epimerase
essential
no
ec
5.1.3.13
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.7|Biosynthesis of rhamnose (for the exosporium)]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    3,882,979 → 3,883,434

    Phenotypes of a mutant

  • production of spores lacking a visible crust [pubmed|31235516]
  • The protein

    Structure

  • [PDB|3RYK] (dTDP-4-dehydrorhamnose 3,5-epimerase (''rfbC'') from ''Bacillus anthracis'' str. Ames with TDP and PPi bound, 32% identity, 56% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|219B0AAFB4ABB7E97A906553B73423F712505E27|spsA]-[gene|9E577B935FAB9605DAF83353E907A6561F11CAC1|spsB]-[gene|38DBA751456A0C0EC5D028939ADB8860ADA28F94|spsC]-[gene|2648D9E356683F5E9C00C40F0A6BBD1933322B09|spsD]-[gene|F27921CD9B89EB16AA57ACECEDBF21ED383629F0|spsE]-[gene|222F7086A214A427174E188CB1FEE4A8B98D303C|spsF]-[gene|9B34C9DBEC5B84A631CDFBEE8DF44384FF5C03B0|spsG]-[gene|8A80A058F270C134891CBCE7EBD8D7A23797F599|spsI]-[gene|90D505CAA4FAAEB6A6AF5C278E70DF714FACB4DA|spsJ]-[gene|4A4C5E6C1DFD46BC3CF9AEBA3FC1577767FF8465|spsK]-[gene|F87238E9B22F967370971ABA4F911EFAC4F559B5|spsL]
    description
    [Pubmed|9353933]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|26577401], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|25239894,15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during [SW|sporulation] in the mother cell ([SW|SigE], [protein|search|SigK], [protein|search|GerE]) [Pubmed|26577401,25239894,15383836]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • BKE37810 (Δ[gene|F87238E9B22F967370971ABA4F911EFAC4F559B5|spsL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATTTTTTCACCTTGA, downstream forward: _UP4_TAAAAATAGGAACGTGATCA
  • BKK37810 (Δ[gene|F87238E9B22F967370971ABA4F911EFAC4F559B5|spsL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATTTTTTCACCTTGA, downstream forward: _UP4_TAAAAATAGGAACGTGATCA
  • References

  • 9353933,15383836,22960854,25239894,26577401,31235516,32817102