SubtiBank SubtiBank
fur
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

fur

transcription regulator of iron homoeostasis, sensor of Fe sufficiency
locus
BSU_23520
pI
5.37
mw
17.26 kDa
protein length
149 aa Sequence Blast
gene length
450 bp Sequence Blast
function
regulation of iron homoeostasis
product
transcriptional repressor [SW|Fur family]
essential
no
synonyms
yqkL

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.3|Acquisition of iron / Other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.1|Acquisition of iron / Other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    2,449,841 → 2,450,290

    Phenotypes of a mutant

  • no growth with glucose and ammonium as single sources of carbon and nitrogen, respectively (due to [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]-mediated repression of the ''[gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]'' operon) [Pubmed|22389480]
  • poor growth on lactate as single carbon source (due to overexpression of [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]-mediated repression of the ''[gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]-[gene|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|lutB]-[gene|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|lutC]'' operon, can be suppressed by inactivation of ''[gene|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|fsrA]'' or ''[gene|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|fbpB]'') [Pubmed|22427629]
  • transcription profile of a ''[gene|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]'' mutant strain: [http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE27416 GEO] [Pubmed|22389480]
  • The protein

    Protein family

  • [SW|Fur family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR], [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]
  • [SW|Cofactors]

  • Fe2+ [pubmed|28938859]
  • Effectors of protein activity

  • DNA binding activity (repression) is triggered by binding of Fe2+ [Pubmed|23057863]
  • Structure

  • [PDB|4ETS] (from Campylobacter jejuni, 33% identity) [pubmed|22665794]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]
    description
    [Pubmed|12029044]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029044], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|12029044], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • repressed in the absence of hydrogen peroxide ([protein|search|PerR]) [Pubmed|12029044]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C426 (yqkL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2424 NBRP B. subtilis, Japan]
  • HB6543 (aphA3), available in the [SW|John Helmann] lab; also available in the [SW|Stülke] lab GP879 (''fur::mls'') and GP868 (''fur::mls'', ''perR::spc'')
  • 1A910 ( ''fur''::''kan''), [Pubmed|12029044], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A910&Search=1A910 BGSC]
  • BKE23520 (Δ[gene|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTTTCCCTCCTACGC, downstream forward: _UP4_TAGACGGTGCCGAGCGCGAA
  • BKK23520 (Δ[gene|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTTTCCCTCCTACGC, downstream forward: _UP4_TAGACGGTGCCGAGCGCGAA
  • References

    Reviews

  • 15802251,25209494,25160631,28938859
  • The [SW|Fur regulon]

  • 12374814,12354229,22389480,21873409,29133393
  • Other original publications

  • 18487332,14563870,18697947,10400588,11790741,12207695,9701813,12029044,22427629,17725565,17012385,12950915,19508286,16672620,23057863,25486128,28439033,29133393,30377275,22665794
  • Labs working on this gene/protein

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]