SubtiBank SubtiBank
fadM

fadM

fatty acid degradation, similar to proline dehydrogenase
locus
BSU_32850
pI
9.38
mw
34.30 kDa
protein length
302 aa Sequence Blast
gene length
909 bp Sequence Blast
function
fatty acid degradation
product
unknown
essential
no
synonyms
yusM

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.3|Utilization of fatty acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    3,372,740 → 3,373,648

    The protein

    Catalyzed reaction/ biological activity

  • quinone + L-proline --> (S)-1-pyrroline-5-carboxylate + quinol + H+ (according to UniProt)
  • Protein family

  • proline dehydrogenase family (with [protein|1F548515402950572E7212901729B2480432D1B9|PutB], according to UniProt)
  • Paralogous protein(s)

  • [protein|1F548515402950572E7212901729B2480432D1B9|PutB]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|4H6Q] (from Deinococcus radiodurans, 48% identity) [pubmed|23151026]
  • Expression and Regulation

    Operons

    genes
    [gene|F8C51A86268DC6B2152B139D2D0B25CC3D69A5D5|fadM]-[gene|4787161A022E938A6D58A505D92369F889C7DE04|fadN]-[gene|07498A0A3CB598A6E388540124A4F56E781C86FA|fadA]-[gene|B5325CBF1408E2CA227EB462092E209F4C87E797|fadE]
    description
    [Pubmed|17189250]

    regulatory mechanism

  • [protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]: repression, [Pubmed|17189250], in [regulon|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR regulon]
  • [protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR]: activation, [Pubmed|12817086], in [regulon|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR regulon]
  • regulation

  • ''[protein|search|fadM]'': induced by long-chain fatty acids ([protein|search|FadR]) [Pubmed|17189250]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A598 (yusM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/598 NBRP B. subtilis, Japan]
  • BKE32850 (Δ[gene|F8C51A86268DC6B2152B139D2D0B25CC3D69A5D5|fadM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGACTCCCTCCCGCCG, downstream forward: _UP4_TGAAAGCAGCCGTGGGAAGC
  • BKK32850 (Δ[gene|F8C51A86268DC6B2152B139D2D0B25CC3D69A5D5|fadM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGACTCCCTCCCGCCG, downstream forward: _UP4_TGAAAGCAGCCGTGGGAAGC
  • References

  • 17189250,12817086,23151026