SubtiBank SubtiBank
maeN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

maeN

Na+/malate symporter
locus
BSU31580
pI
8.41
mw
47.66 kDa
protein length
448 aa Sequence Blast
gene length
1347 bp Sequence Blast
function
malate uptake
product
Na+/malate symporter
essential
no
synonyms
yufR

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.4|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,244,770 → 3,246,116

    The protein

    Protein family

  • sodium:citrate (SCF) symporter family 2-hydroxycarboxylate transporter family (together with [protein|FEC0EDE9663FE62B2A1A4FA5B16B41048DDD723B|CimH]) (according to UniProt)
  • Paralogous protein(s)

  • [protein|FEC0EDE9663FE62B2A1A4FA5B16B41048DDD723B|CimH]
  • Structure

  • [PDB|5X9R] (from Klebsiella pneumoniae, 34% identity) [pubmed|28566738]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|F8F62635AA87E4E3A255D6F8FC621EF40954B520|maeN]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR]: activation, in [regulon|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR regulon]
  • regulation

  • induced by malate ([protein|search|MalR])
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B556 (yufR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1555 NBRP B. subtilis, Japan]
  • 1A642 (''maeN''::Tn917, erm) (available from the [http://www.bgsc.org/ BGSC] or in [SW|Jörg Stülke]'s lab)
  • 1A642 ( ''maeN''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A642&Search=1A642 BGSC]
  • GP1449 (''erm''), available in [SW|Stülke] lab
  • BKE31580 (Δ[gene|F8F62635AA87E4E3A255D6F8FC621EF40954B520|maeN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATACACCCCCATGT, downstream forward: _UP4_TAAACAGAAAGAGTTCCGTT
  • BKK31580 (Δ[gene|F8F62635AA87E4E3A255D6F8FC621EF40954B520|maeN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATACACCCCCATGT, downstream forward: _UP4_TAAACAGAAAGAGTTCCGTT
  • Expression vectors

  • expression of native ''maeN'' in ''B. subtilis'': pGP1951 (in [SW|pBQ200]), available in [SW|Stülke] lab
  • References

    Reviews

  • 16339740
  • Original publications

  • 19087206,12949159,12949159,21815947,28566738