SubtiBank SubtiBank
nadA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

nadA

quinolinate synthetase
locus
BSU_27850
pI
5.72
mw
41.33 kDa
protein length
368 aa Sequence Blast
gene length
1107 bp Sequence Blast
function
NAD biosynthesis
product
quinolinate synthetase
essential
no
ec
2.5.1.72
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.11|Biosynthesis of NAD(P)]
  • Gene

    Coordinates
    2,845,955 → 2,847,061

    The protein

    Catalyzed reaction/ biological activity

  • ATP + L-threonyl-[protein] --> ADP + H+ + O-phospho-L-threonyl-[protein] (according to UniProt)
  • Protein family

  • quinolinate synthase A family (single member, according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [Pubmed|18959769]
  • Structure

  • [PDB|4HHE] (from Pyrococcus furiosus, 34% identity) [pubmed|23999292]
  • Expression and Regulation

    Operons

    genes
    [gene|D30D059185DFB828AB0FD07D600DBC3FD0973198|nadB]-[gene|1368734DCC28C618AA173B865784BDDAEA912623|nadC]-[gene|F92F17578F06EF2292D0923662933463D7C86498|nadA]
    description
    [Pubmed|8444804]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8444804], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|510DE075EA964D22C42DEB171509F6CDA600A402|NadR]: repression, [Pubmed|16199587], in [regulon|510DE075EA964D22C42DEB171509F6CDA600A402|NadR regulon]
  • regulation

  • repressed in the presence of nicotinic acid ([protein|search|NadR]) [Pubmed|16199587]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|nadB]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE27850 (Δ[gene|F92F17578F06EF2292D0923662933463D7C86498|nadA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATTCGATTGTTTGA, downstream forward: _UP4_TAGATCAGAAATATTTTCCC
  • BKK27850 (Δ[gene|F92F17578F06EF2292D0923662933463D7C86498|nadA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATTCGATTGTTTGA, downstream forward: _UP4_TAGATCAGAAATATTTTCCC
  • labs

  • [SW|Alessandra Albertini], University of Pavia, Italy [http://www-1.unipv.it/genbiom/albertini.html homepage]
  • References

  • 18959769,16199587,8444804,23999292